Transcript: Human NM_001369145.1

Homo sapiens cullin 4B (CUL4B), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CUL4B (8450)
Length:
4401
CDS:
99..2252

Additional Resources:

NCBI RefSeq record:
NM_001369145.1
NBCI Gene record:
CUL4B (8450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006535 GCAGAATTTAAAGAGGGTAAA pLKO.1 1710 CDS 100% 10.800 15.120 N CUL4B n/a
2 TRCN0000352771 GCAGAATTTAAAGAGGGTAAA pLKO_005 1710 CDS 100% 10.800 15.120 N CUL4B n/a
3 TRCN0000012790 GCTGTCTGATTTGCAAATTTA pLKO.1 632 CDS 100% 15.000 10.500 N Cul4b n/a
4 TRCN0000273756 GCTGTCTGATTTGCAAATTTA pLKO_005 632 CDS 100% 15.000 10.500 N Cul4b n/a
5 TRCN0000006536 GCAATTCTTCAGAAAGGTTTA pLKO.1 873 CDS 100% 10.800 7.560 N CUL4B n/a
6 TRCN0000352770 GCAATTCTTCAGAAAGGTTTA pLKO_005 873 CDS 100% 10.800 7.560 N CUL4B n/a
7 TRCN0000006532 GCCATGAAAGAAGCATTTGAA pLKO.1 1137 CDS 100% 5.625 3.938 N CUL4B n/a
8 TRCN0000342588 GCCATGAAAGAAGCATTTGAA pLKO_005 1137 CDS 100% 5.625 3.938 N CUL4B n/a
9 TRCN0000006533 CCTGAATATCTACATCATGTT pLKO.1 741 CDS 100% 4.950 3.465 N CUL4B n/a
10 TRCN0000342635 CCTGAATATCTACATCATGTT pLKO_005 741 CDS 100% 4.950 3.465 N CUL4B n/a
11 TRCN0000006534 CGGGACTACATGGAAAGAGAT pLKO.1 2196 CDS 100% 4.950 3.465 N CUL4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07242 pDONR223 100% 78.2% 77.7% None (many diffs) n/a
2 TRCN0000478902 TTCATTGCTAGTTGATATCTTTTC pLX_317 12.9% 78.2% 77.7% V5 (many diffs) n/a
Download CSV