Transcript: Human NM_001369160.1

Homo sapiens chromosome 11 open reading frame 45 (C11orf45), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-03-21
Taxon:
Homo sapiens (human)
Gene:
C11orf45 (219833)
Length:
3538
CDS:
166..546

Additional Resources:

NCBI RefSeq record:
NM_001369160.1
NBCI Gene record:
C11orf45 (219833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005600 GCCCGATTCAAGGTATGGAAT pLKO.1 3013 3UTR 100% 4.950 6.930 N C11orf45 n/a
2 TRCN0000005603 GCCATAGTAACCAGAACCTGT pLKO.1 319 CDS 100% 2.640 3.696 N C11orf45 n/a
3 TRCN0000371382 CGATGTAATGGATGCTGATTA pLKO_005 849 3UTR 100% 13.200 9.240 N C11orf45 n/a
4 TRCN0000371381 CTGATGCCTAGTCCCAGAATC pLKO_005 259 CDS 100% 10.800 7.560 N C11orf45 n/a
5 TRCN0000005604 TCAATCTGCAAGGCCCATGAT pLKO.1 460 CDS 100% 4.950 3.465 N C11orf45 n/a
6 TRCN0000005601 CCACAAACATTACCTGTCAGT pLKO.1 395 CDS 100% 2.640 1.848 N C11orf45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05230 pDONR223 100% 86.8% 86.8% None 133_134ins57 n/a
2 ccsbBroad304_05230 pLX_304 0% 86.8% 86.8% V5 133_134ins57 n/a
3 TRCN0000465757 TTCGTGCACGGCGTCCGCCCGGGT pLX_317 60.4% 86.8% 86.8% V5 133_134ins57 n/a
Download CSV