Transcript: Human NM_001369507.1

Homo sapiens Mov10 RISC complex RNA helicase (MOV10), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
MOV10 (4343)
Length:
3419
CDS:
176..3187

Additional Resources:

NCBI RefSeq record:
NM_001369507.1
NBCI Gene record:
MOV10 (4343)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419396 ACGTTAGTGGAGGCAATTAAG pLKO_005 1772 CDS 100% 13.200 18.480 N MOV10 n/a
2 TRCN0000425452 GGCCAGTGTTTCGAGAGTTTC pLKO_005 215 CDS 100% 10.800 15.120 N MOV10 n/a
3 TRCN0000049978 CGCGACTTCAAGATCAGCTTT pLKO.1 296 CDS 100% 4.950 6.930 N MOV10 n/a
4 TRCN0000049980 CCATCATCTTTCACGGCGTAA pLKO.1 2499 CDS 100% 4.050 5.670 N MOV10 n/a
5 TRCN0000049979 CCCATCACATATAAGGGCTTT pLKO.1 1403 CDS 100% 4.050 5.670 N MOV10 n/a
6 TRCN0000049982 CGTTACTGCATCACCAAACTT pLKO.1 2696 CDS 100% 5.625 4.500 N MOV10 n/a
7 TRCN0000049981 GCTGACCTTCAAGGTGAACTT pLKO.1 1495 CDS 100% 4.950 3.465 N MOV10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01030 pDONR223 100% 100% 100% None n/a
Download CSV