Transcript: Human NM_001369695.1

Homo sapiens N-acetyltransferase 16 (putative) (NAT16), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-04-15
Taxon:
Homo sapiens (human)
Gene:
NAT16 (375607)
Length:
2837
CDS:
145..1254

Additional Resources:

NCBI RefSeq record:
NM_001369695.1
NBCI Gene record:
NAT16 (375607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165003 GCCTTCTAGTGCAACTGGAAT pLKO.1 2247 3UTR 100% 4.950 6.930 N NAT16 n/a
2 TRCN0000163541 GAAATACCGCCTAATCACCAA pLKO.1 657 CDS 100% 2.640 3.696 N NAT16 n/a
3 TRCN0000164756 CTATCTCAACATCGACGCCTT pLKO.1 1029 CDS 100% 2.160 3.024 N NAT16 n/a
4 TRCN0000161716 GAAGGGTTATACTGAACAGTA pLKO.1 1212 CDS 100% 4.950 3.960 N NAT16 n/a
5 TRCN0000163940 GCTGAAGAAATACCGCCTAAT pLKO.1 651 CDS 100% 10.800 7.560 N NAT16 n/a
6 TRCN0000160971 GCTTTGCACAACTTTGCTATT pLKO.1 2069 3UTR 100% 10.800 7.560 N NAT16 n/a
7 TRCN0000165418 CGTAGGTGCTAGGAGAATGTT pLKO.1 2579 3UTR 100% 5.625 3.938 N NAT16 n/a
8 TRCN0000165561 GCTGGTGAAGGGTTATACTGA pLKO.1 1206 CDS 100% 3.000 2.100 N NAT16 n/a
9 TRCN0000165467 GAGCTGAAGAAATACCGCCTA pLKO.1 649 CDS 100% 2.160 1.512 N NAT16 n/a
10 TRCN0000164757 CCAGAGAGAGAGAGAGTGATA pLKO.1 1949 3UTR 100% 4.950 2.475 Y NAT16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10072 pDONR223 100% 99.9% 99.7% None 188T>C n/a
2 ccsbBroad304_10072 pLX_304 0% 99.9% 99.7% V5 188T>C n/a
3 TRCN0000477745 GACCCGTATCGCCTCCAACACTAA pLX_317 19% 99.9% 99.7% V5 188T>C n/a
Download CSV