Transcript: Human NM_001369700.1

Homo sapiens NFKB inhibitor beta (NFKBIB), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
NFKBIB (4793)
Length:
916
CDS:
65..859

Additional Resources:

NCBI RefSeq record:
NM_001369700.1
NBCI Gene record:
NFKBIB (4793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018558 GAATACGACGACATTGTGGTT pLKO.1 761 CDS 100% 2.640 3.696 N NFKBIB n/a
2 TRCN0000018557 GTGGCCGTTATCCACAAAGAT pLKO.1 425 CDS 100% 5.625 3.938 N NFKBIB n/a
3 TRCN0000018556 GCTGTGATTCATCAGCATGAA pLKO.1 257 CDS 100% 0.495 0.347 N NFKBIB n/a
4 TRCN0000275102 GCTGTGATTCATCAGCATGAA pLKO_005 257 CDS 100% 0.495 0.347 N NFKBIB n/a
5 TRCN0000275155 AGATGCTGGAGCTGACCTTGA pLKO_005 469 CDS 100% 4.050 2.430 N NFKBIB n/a
6 TRCN0000275104 TGGACCTGCAGAATGACCTAG pLKO_005 324 CDS 100% 4.050 2.430 N NFKBIB n/a
7 TRCN0000018560 GCAGCCGATGTGCTGGAGCTT pLKO.1 545 CDS 100% 0.000 0.000 N NFKBIB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01094 pDONR223 100% 74.1% 74.1% None 283_284ins276 n/a
2 ccsbBroad304_01094 pLX_304 53% 74.1% 74.1% V5 283_284ins276 n/a
3 TRCN0000471386 TAAACTCTGGATCGGATTACCTCC pLX_317 45.1% 74.1% 74.1% V5 283_284ins276 n/a
Download CSV