Transcript: Human NM_001369705.1

Homo sapiens zinc finger protein Y-linked (ZFY), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ZFY (7544)
Length:
5113
CDS:
273..2600

Additional Resources:

NCBI RefSeq record:
NM_001369705.1
NBCI Gene record:
ZFY (7544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017329 GCTGTGCATGAGCAGCAAATT pLKO.1 1203 CDS 100% 13.200 9.240 N ZFY n/a
2 TRCN0000017330 CTATCCTCATAAGTGTGAGAT pLKO.1 2159 CDS 100% 4.950 3.465 N ZFY n/a
3 TRCN0000017328 GCTAATATAAATGGGAGGTTT pLKO.1 2998 3UTR 100% 4.950 3.465 N ZFY n/a
4 TRCN0000017331 GCAGAAATCATTACTGATCCT pLKO.1 672 CDS 100% 2.640 1.848 N ZFY n/a
5 TRCN0000017332 ACTGTCAATGACTCTCAACAA pLKO.1 1086 CDS 100% 4.950 2.970 N ZFY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01791 pDONR223 100% 93.4% 93.2% None 851_1003del n/a
2 TRCN0000477192 CGGTAAATAATATAGGTCCGTATT pLX_317 20.2% 93.4% 93.2% V5 851_1003del n/a
Download CSV