Transcript: Human NM_001369788.1

Homo sapiens sodium voltage-gated channel alpha subunit 8 (SCN8A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SCN8A (6334)
Length:
11436
CDS:
182..6001

Additional Resources:

NCBI RefSeq record:
NM_001369788.1
NBCI Gene record:
SCN8A (6334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044492 CCCATACTATTTGACGCAGAA pLKO.1 436 CDS 100% 4.050 5.670 N SCN8A n/a
2 TRCN0000044488 GCCCTGATAGTTTCAAGCCTT pLKO.1 210 CDS 100% 2.640 3.696 N SCN8A n/a
3 TRCN0000044489 CCTGGCAGATATAATTGAGAA pLKO.1 4861 CDS 100% 4.950 3.960 N SCN8A n/a
4 TRCN0000416608 ACTCTAACCTGAAGATCTATA pLKO_005 6100 3UTR 100% 13.200 9.240 N SCN8A n/a
5 TRCN0000415665 AGCAATGTTGGAGCAACTTAA pLKO_005 1480 CDS 100% 13.200 9.240 N SCN8A n/a
6 TRCN0000436809 CACTGGTGCTGGCCATTATTG pLKO_005 2817 CDS 100% 13.200 9.240 N SCN8A n/a
7 TRCN0000044490 CCATCCTATGACACCACAATT pLKO.1 2503 CDS 100% 13.200 9.240 N SCN8A n/a
8 TRCN0000069062 CCTGCTCTTTGCCTTAATGAT pLKO.1 4975 CDS 100% 5.625 3.938 N Scn8a n/a
9 TRCN0000044491 GCAGCCTAAGTATGAGGACAA pLKO.1 4348 CDS 100% 4.050 2.835 N SCN8A n/a
10 TRCN0000374811 GAAGCAGAAAGCATCACTTTA pLKO_005 6369 3UTR 100% 13.200 6.600 Y Scn8a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.