Transcript: Human NM_001369803.2

Homo sapiens alkaline phosphatase, biomineralization associated (ALPL), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
ALPL (249)
Length:
2600
CDS:
264..1838

Additional Resources:

NCBI RefSeq record:
NM_001369803.2
NBCI Gene record:
ALPL (249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359333 CATTCTCAAAGCCTCTTATTT pLKO_005 2116 3UTR 100% 15.000 10.500 N ALPL n/a
2 TRCN0000052005 GCGCAAGAGACACTGAAATAT pLKO.1 360 CDS 100% 15.000 10.500 N ALPL n/a
3 TRCN0000359331 TTTGGCCAACAGGGTAGATTT pLKO_005 2063 3UTR 100% 13.200 9.240 N ALPL n/a
4 TRCN0000359332 AGTATGAGAGTGACGAGAAAG pLKO_005 967 CDS 100% 10.800 7.560 N ALPL n/a
5 TRCN0000359258 ATGTCTCCATGGTGGACTATG pLKO_005 1552 CDS 100% 10.800 7.560 N ALPL n/a
6 TRCN0000052003 CCCACAATGTGGACTACCTAT pLKO.1 1102 CDS 100% 4.950 3.465 N ALPL n/a
7 TRCN0000052004 CGTGGCTAAGAATGTCATCAT pLKO.1 410 CDS 100% 4.950 3.465 N ALPL n/a
8 TRCN0000052006 GAAGAGCTTCAAACCGAGATA pLKO.1 1031 CDS 100% 4.950 3.465 N ALPL n/a
9 TRCN0000052007 ACTGCCATCCTGTATGGCAAT pLKO.1 1494 CDS 100% 0.405 0.284 N ALPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05807 pDONR223 100% 99.8% 99.8% None 330T>C;787T>C;876A>G n/a
2 ccsbBroad304_05807 pLX_304 0% 99.8% 99.8% V5 330T>C;787T>C;876A>G n/a
3 TRCN0000481444 TTGTCTGAGCACATACCTAATACC pLX_317 27.9% 99.8% 99.8% V5 330T>C;787T>C;876A>G n/a
Download CSV