Transcript: Human NM_001370239.1

Homo sapiens poly(ADP-ribose) polymerase family member 3 (PARP3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PARP3 (10039)
Length:
2459
CDS:
471..2072

Additional Resources:

NCBI RefSeq record:
NM_001370239.1
NBCI Gene record:
PARP3 (10039)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230904 ACCCGCAGAGAAGCGCATAAT pLKO_005 587 CDS 100% 13.200 18.480 N PARP3 n/a
2 TRCN0000218494 CAAGTCAGCTGGATATGTTAT pLKO_005 1730 CDS 100% 13.200 18.480 N PARP3 n/a
3 TRCN0000052942 CCAGTCAAAGATCAACCACTT pLKO.1 794 CDS 100% 4.050 5.670 N PARP3 n/a
4 TRCN0000230907 GTACAAGATCCCTGAACTTAT pLKO_005 2207 3UTR 100% 13.200 9.240 N PARP3 n/a
5 TRCN0000230905 AGGTGATACAGACCTACTTAG pLKO_005 1480 CDS 100% 10.800 7.560 N PARP3 n/a
6 TRCN0000230906 CCCACTCCAAACTGGGTAATC pLKO_005 1585 CDS 100% 10.800 7.560 N PARP3 n/a
7 TRCN0000052940 CCAGACCAACATCGAGAACAA pLKO.1 683 CDS 100% 4.950 3.465 N PARP3 n/a
8 TRCN0000052938 CCCTGAACTTATGCCTCCTAA pLKO.1 2216 3UTR 100% 4.950 3.465 N PARP3 n/a
9 TRCN0000052941 GCACCATATCAACACGGACAA pLKO.1 1817 CDS 100% 4.050 2.835 N PARP3 n/a
10 TRCN0000052939 GCACCTGAGTACAAGGTGATA pLKO.1 1467 CDS 100% 0.495 0.347 N PARP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07535 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_07535 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470245 CTTCCATTAAACTTTTAGGTTCAA pLX_317 29.4% 100% 100% V5 n/a
Download CSV