Transcript: Human NM_001370330.1

Homo sapiens E74 like ETS transcription factor 1 (ELF1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ELF1 (1997)
Length:
4138
CDS:
778..2637

Additional Resources:

NCBI RefSeq record:
NM_001370330.1
NBCI Gene record:
ELF1 (1997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232059 TTTAGTTGACTGCACTATATA pLKO_005 3108 3UTR 100% 15.000 21.000 N ELF1 n/a
2 TRCN0000013856 CCTGCCGTAATTGTGGAACAT pLKO.1 871 CDS 100% 4.950 6.930 N ELF1 n/a
3 TRCN0000232057 AGCGCTTGGTGTATCAGTTTA pLKO_005 1625 CDS 100% 13.200 10.560 N ELF1 n/a
4 TRCN0000013857 CGTTCAGAGTATTAGGACTAT pLKO.1 2019 CDS 100% 4.950 3.960 N ELF1 n/a
5 TRCN0000232056 AGAGCACTCAGGTACTATTAC pLKO_005 1573 CDS 100% 13.200 9.240 N ELF1 n/a
6 TRCN0000232055 ATGTTCCTGGTGCTGATATTC pLKO_005 890 CDS 100% 13.200 9.240 N ELF1 n/a
7 TRCN0000013854 GCCACTTCAAATAGGAATCAA pLKO.1 1732 CDS 100% 5.625 3.938 N ELF1 n/a
8 TRCN0000013855 GCACTGTAATCACTTCAGTTA pLKO.1 2426 CDS 100% 4.950 3.465 N ELF1 n/a
9 TRCN0000013853 GCAGAGAAATAAGTGACCCAA pLKO.1 3440 3UTR 100% 2.640 1.848 N ELF1 n/a
10 TRCN0000232058 TACTGGATCTCAGAAGTTTAT pLKO_005 2157 CDS 100% 13.200 7.920 N ELF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06155 pDONR223 100% 99.9% 100% None 942G>A n/a
2 ccsbBroad304_06155 pLX_304 0% 99.9% 100% V5 942G>A n/a
Download CSV