Transcript: Human NM_001370457.1

Homo sapiens zinc finger protein 577 (ZNF577), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ZNF577 (84765)
Length:
2635
CDS:
367..693

Additional Resources:

NCBI RefSeq record:
NM_001370457.1
NBCI Gene record:
ZNF577 (84765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016696 CAAGCCAGATTCGCTCTTCAA pLKO.1 567 CDS 100% 4.950 3.465 N ZNF577 n/a
2 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1210 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12854 pDONR223 100% 20.1% 17.9% None (many diffs) n/a
2 ccsbBroad304_12854 pLX_304 0% 20.1% 17.9% V5 (many diffs) n/a
3 TRCN0000470731 ACAATCTGAACATGTGTTTCTGTC pLX_317 33.8% 20.1% 17.9% V5 (many diffs) n/a
Download CSV