Transcript: Human NM_001370460.1

Homo sapiens galactosidase beta 1 like 2 (GLB1L2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-08
Taxon:
Homo sapiens (human)
Gene:
GLB1L2 (89944)
Length:
3413
CDS:
75..2147

Additional Resources:

NCBI RefSeq record:
NM_001370460.1
NBCI Gene record:
GLB1L2 (89944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163984 CCGAAGCAGTGGACCTTTATT pLKO.1 577 CDS 100% 15.000 21.000 N GLB1L2 n/a
2 TRCN0000330548 ATCGTGGGCGAGTCAACTATG pLKO_005 1696 CDS 100% 10.800 15.120 N GLB1L2 n/a
3 TRCN0000369769 CCTTCGGGTACATTCTCTATG pLKO_005 1516 CDS 100% 10.800 15.120 N GLB1L2 n/a
4 TRCN0000369698 GATGCCGTATGAGCCCTTAAC pLKO_005 1382 CDS 100% 10.800 15.120 N GLB1L2 n/a
5 TRCN0000164002 CCTGCATTACAGTTCACGGAA pLKO.1 2091 CDS 100% 2.640 3.696 N GLB1L2 n/a
6 TRCN0000330549 ACCAGCGCAAAGGCTTAATTG pLKO_005 1732 CDS 100% 13.200 9.240 N GLB1L2 n/a
7 TRCN0000353744 ACTACAAGACAACGAAGATTG pLKO_005 1627 CDS 100% 10.800 7.560 N GLB1L2 n/a
8 TRCN0000330550 CACCGAAGCAGTGGACCTTTA pLKO_005 575 CDS 100% 10.800 7.560 N GLB1L2 n/a
9 TRCN0000330493 GTCTCACCTGAGCTGACTTTG pLKO_005 2621 3UTR 100% 10.800 7.560 N GLB1L2 n/a
10 TRCN0000161224 GAGCTGACTTTGTTCTTCCTT pLKO.1 2630 3UTR 100% 3.000 2.100 N GLB1L2 n/a
11 TRCN0000244668 CAACCTTCTGAGCCTTCTTTG pLKO_005 2653 3UTR 100% 10.800 6.480 N GLB1L2 n/a
12 TRCN0000161754 CCACATTACCTGCTTTCTTCT pLKO.1 1870 CDS 100% 4.950 2.970 N GLB1L2 n/a
13 TRCN0000159723 GACTTTGTTCTTCCTTCACAA pLKO.1 2635 3UTR 100% 4.950 2.970 N GLB1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04500 pDONR223 100% 92.1% 92.1% None 732_893del n/a
2 ccsbBroad304_04500 pLX_304 0% 92.1% 92.1% V5 732_893del n/a
3 TRCN0000468177 GCCAGAGGAGTAGCTTTAGACTGA pLX_317 22.5% 92.1% 92.1% V5 732_893del n/a
Download CSV