Transcript: Human NM_001370463.1

Homo sapiens galactosidase beta 1 like 2 (GLB1L2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-08
Taxon:
Homo sapiens (human)
Gene:
GLB1L2 (89944)
Length:
1104
CDS:
75..569

Additional Resources:

NCBI RefSeq record:
NM_001370463.1
NBCI Gene record:
GLB1L2 (89944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 982 3UTR 100% 5.625 2.813 Y KLHL30 n/a
2 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 982 3UTR 100% 5.625 2.813 Y EID2B n/a
3 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 745 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04500 pDONR223 100% 24.5% 23.5% None (many diffs) n/a
2 ccsbBroad304_04500 pLX_304 0% 24.5% 23.5% V5 (many diffs) n/a
3 TRCN0000468177 GCCAGAGGAGTAGCTTTAGACTGA pLX_317 22.5% 24.5% 23.5% V5 (many diffs) n/a
Download CSV