Transcript: Human NM_001370487.1

Homo sapiens potassium channel tetramerization domain containing 16 (KCTD16), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-08
Taxon:
Homo sapiens (human)
Gene:
KCTD16 (57528)
Length:
13896
CDS:
1038..2324

Additional Resources:

NCBI RefSeq record:
NM_001370487.1
NBCI Gene record:
KCTD16 (57528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370487.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069800 GTTCCGTTATATTCTGGACTA pLKO.1 1280 CDS 100% 4.050 5.670 N Kctd16 n/a
2 TRCN0000128551 GTTCCGTTATATTCTGGACTA pLKO.1 1280 CDS 100% 4.050 5.670 N KCTD16 n/a
3 TRCN0000129305 CACGGCTAATGATCTAGCCAA pLKO.1 1217 CDS 100% 0.264 0.370 N KCTD16 n/a
4 TRCN0000128363 GCAAAGAATCACAGAGCTTAA pLKO.1 4363 3UTR 100% 10.800 7.560 N KCTD16 n/a
5 TRCN0000129573 CCAAGGAAGCGACACAAGAAT pLKO.1 1466 CDS 100% 5.625 3.938 N KCTD16 n/a
6 TRCN0000128904 GAATCGAACATGAGCAGCAAA pLKO.1 2160 CDS 100% 4.950 3.465 N KCTD16 n/a
7 TRCN0000129366 GCTGATCCAACAGTCAGAGAT pLKO.1 2093 CDS 100% 4.950 3.465 N KCTD16 n/a
8 TRCN0000069799 CAGAAAGATACACCTCCAGAT pLKO.1 1693 CDS 100% 4.050 2.835 N Kctd16 n/a
9 TRCN0000129601 CTGCCTGATCACTTTCCAGAA pLKO.1 1323 CDS 100% 4.050 2.835 N KCTD16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370487.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03827 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03827 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476014 TTGCCGCTCATATGCTACTTAATG pLX_317 28% 100% 100% V5 n/a
Download CSV