Transcript: Human NM_001370586.1

Homo sapiens nudix hydrolase 16 like 1 (NUDT16L1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
NUDT16L1 (84309)
Length:
1374
CDS:
10..582

Additional Resources:

NCBI RefSeq record:
NM_001370586.1
NBCI Gene record:
NUDT16L1 (84309)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179905 CCTCAGGATGCTCTTGTTTAT pLKO.1 946 3UTR 100% 13.200 9.240 N NUDT16L1 n/a
2 TRCN0000245610 TGGATTTACTTTGCTAGATTT pLKO_005 1204 3UTR 100% 13.200 9.240 N NUDT16L1 n/a
3 TRCN0000245607 CTAAGTGCCAGCTCCTCTTTG pLKO_005 579 CDS 100% 10.800 7.560 N NUDT16L1 n/a
4 TRCN0000245608 CCTCAAGGTGCTCAACATGAT pLKO_005 601 3UTR 100% 4.950 3.465 N NUDT16L1 n/a
5 TRCN0000183565 GTTGTTGGATTTACTTTGCTA pLKO.1 1199 3UTR 100% 3.000 2.100 N NUDT16L1 n/a
6 TRCN0000245609 CAACTTCCTGAGCAACGCCTT pLKO_005 547 CDS 100% 2.160 1.512 N NUDT16L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04371 pDONR223 100% 71.1% 66.9% None 152_153insGATGCA;408_477del;570_571ins127 n/a
2 ccsbBroad304_04371 pLX_304 0% 71.1% 66.9% V5 152_153insGATGCA;408_477del;570_571ins127 n/a
3 TRCN0000474867 TGCCAAACACAACCTCCGGGTTAA pLX_317 80.5% 71.1% 66.9% V5 152_153insGATGCA;408_477del;570_571ins127 n/a
Download CSV