Transcript: Human NM_001370587.1

Homo sapiens nudix hydrolase 16 like 1 (NUDT16L1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
NUDT16L1 (84309)
Length:
1190
CDS:
10..525

Additional Resources:

NCBI RefSeq record:
NM_001370587.1
NBCI Gene record:
NUDT16L1 (84309)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179905 CCTCAGGATGCTCTTGTTTAT pLKO.1 762 3UTR 100% 13.200 9.240 N NUDT16L1 n/a
2 TRCN0000245610 TGGATTTACTTTGCTAGATTT pLKO_005 1020 3UTR 100% 13.200 9.240 N NUDT16L1 n/a
3 TRCN0000183565 GTTGTTGGATTTACTTTGCTA pLKO.1 1015 3UTR 100% 3.000 2.100 N NUDT16L1 n/a
4 TRCN0000257452 GTGCTGATGCAGATGCGTTTC pLKO_005 157 CDS 100% 6.000 3.600 N NUDT16L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04371 pDONR223 100% 81% 81% None 412_413ins120 n/a
2 ccsbBroad304_04371 pLX_304 0% 81% 81% V5 412_413ins120 n/a
3 TRCN0000474867 TGCCAAACACAACCTCCGGGTTAA pLX_317 80.5% 81% 81% V5 412_413ins120 n/a
Download CSV