Transcript: Human NM_001371121.1

Homo sapiens coiled-coil domain containing 178 (CCDC178), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-28
Taxon:
Homo sapiens (human)
Gene:
CCDC178 (374864)
Length:
3522
CDS:
242..2917

Additional Resources:

NCBI RefSeq record:
NM_001371121.1
NBCI Gene record:
CCDC178 (374864)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136009 GAGGCCTATTTGAGTGATGTT pLKO.1 905 CDS 100% 4.950 6.930 N CCDC178 n/a
2 TRCN0000428253 TGCTGTCAGGAACGATCTAAT pLKO_005 3114 3UTR 100% 13.200 10.560 N CCDC178 n/a
3 TRCN0000135928 GTCCAGAGTTAAAGCAGGAAA pLKO.1 708 CDS 100% 4.950 3.960 N CCDC178 n/a
4 TRCN0000423523 GCCTACAAGAGAGAGATATAT pLKO_005 1256 CDS 100% 15.000 10.500 N CCDC178 n/a
5 TRCN0000134906 CTGCTTCAACTAGAAGATGAA pLKO.1 2000 CDS 100% 4.950 3.465 N CCDC178 n/a
6 TRCN0000136236 GCCATTTCACACTTCCATGAA pLKO.1 3008 3UTR 100% 4.950 3.465 N CCDC178 n/a
7 TRCN0000137463 GCTGGAATGGTGCTTCAGAAA pLKO.1 1880 CDS 100% 4.950 2.970 N CCDC178 n/a
8 TRCN0000134877 CAATGTATCTTGGATGCTGAA pLKO.1 2927 3UTR 100% 4.050 2.430 N CCDC178 n/a
9 TRCN0000135767 CCAATGTATCTTGGATGCTGA pLKO.1 2926 3UTR 100% 2.640 1.584 N CCDC178 n/a
10 TRCN0000134987 CCATGTCTCAAAGTTTGGTTA pLKO.1 366 CDS 100% 4.950 3.465 N CCDC178 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10067 pDONR223 100% 97.2% 97% None 1394T>A;1801G>A;2386_2457del n/a
2 ccsbBroad304_10067 pLX_304 0% 97.2% 97% V5 1394T>A;1801G>A;2386_2457del n/a
3 TRCN0000474914 GGTGTGCCTGTGAGAGTCACCTAC pLX_317 22.5% 97.2% 97% V5 1394T>A;1801G>A;2386_2457del n/a
Download CSV