Transcript: Human NM_001371160.1

Homo sapiens neuronal cell adhesion molecule (NRCAM), transcript variant 61, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
NRCAM (4897)
Length:
6380
CDS:
526..4119

Additional Resources:

NCBI RefSeq record:
NM_001371160.1
NBCI Gene record:
NRCAM (4897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123081 CGCGAAGACTATATCTGTTAT pLKO.1 1144 CDS 100% 13.200 18.480 N NRCAM n/a
2 TRCN0000123080 GCCTCTAATGAATATGGATAT pLKO.1 1807 CDS 100% 10.800 7.560 N NRCAM n/a
3 TRCN0000123082 CCGAATATGCAGTTGTGCAAA pLKO.1 2162 CDS 100% 4.950 3.465 N NRCAM n/a
4 TRCN0000123079 GCAGCATTAAACAACGTGTAT pLKO.1 5358 3UTR 100% 4.950 3.465 N NRCAM n/a
5 TRCN0000123083 CCCAATTATTTACTGGGCAAA pLKO.1 1404 CDS 100% 4.050 2.835 N NRCAM n/a
6 TRCN0000366146 ATAGATGGCGATACCATTATA pLKO_005 1741 CDS 100% 15.000 21.000 N Nrcam n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13916 pDONR223 100% 64% 63.8% None (many diffs) n/a
2 ccsbBroad304_13916 pLX_304 0% 64% 63.8% V5 (many diffs) n/a
3 TRCN0000480317 GCTAACTGTAAACCGCCTCGATGA pLX_317 14.1% 64% 63.8% V5 (many diffs) n/a
Download CSV