Transcript: Human NM_001371184.1

Homo sapiens complement C1q B chain (C1QB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
C1QB (713)
Length:
1251
CDS:
239..1000

Additional Resources:

NCBI RefSeq record:
NM_001371184.1
NBCI Gene record:
C1QB (713)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377670 GCTCCTGGGCCTAATCGATAT pLKO_005 289 CDS 100% 10.800 8.640 N C1QB n/a
2 TRCN0000371515 TTTCCGGGTTCCTGCTCTTTC pLKO_005 963 CDS 100% 10.800 7.560 N C1QB n/a
3 TRCN0000057158 CAAAGGTGAATCGGGAGACTA pLKO.1 565 CDS 100% 4.950 3.465 N C1QB n/a
4 TRCN0000057161 CGTGATCACCAACATGAACAA pLKO.1 670 CDS 100% 4.950 3.465 N C1QB n/a
5 TRCN0000057160 GCCACCGACAAGAACTCACTA pLKO.1 914 CDS 100% 4.950 3.465 N C1QB n/a
6 TRCN0000371516 GAACCTGTGCGTGAACCTCAT pLKO_005 772 CDS 100% 4.050 2.835 N C1QB n/a
7 TRCN0000057159 CGGTCTCTACTACTTCACCTA pLKO.1 733 CDS 100% 2.640 1.848 N C1QB n/a
8 TRCN0000057162 GTGGTCACCTTCTGTGACTAT pLKO.1 818 CDS 100% 0.495 0.347 N C1QB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00181 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00181 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465822 CTCTAAGCGAGGCTGTCCCCTTAA pLX_317 47.4% 100% 100% V5 n/a
Download CSV