Transcript: Human NM_001371193.1

Homo sapiens C-C motif chemokine ligand 24 (CCL24), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-01
Taxon:
Homo sapiens (human)
Gene:
CCL24 (6369)
Length:
1441
CDS:
111..470

Additional Resources:

NCBI RefSeq record:
NM_001371193.1
NBCI Gene record:
CCL24 (6369)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371614 AGTGATCTTCACCACCAAGAA pLKO_005 296 CDS 100% 4.950 3.465 N CCL24 n/a
2 TRCN0000057904 GTTCTTTGTTTCCAAGAGAAT pLKO.1 215 CDS 100% 4.950 3.465 N CCL24 n/a
3 TRCN0000377746 ATTCCTGAGAACCGAGTGGTC pLKO_005 234 CDS 100% 2.160 1.512 N CCL24 n/a
4 TRCN0000057907 CCGAGTGGTCAGCTACCAGCT pLKO.1 245 CDS 100% 0.000 0.000 N CCL24 n/a
5 TRCN0000057903 CCTGCTGCATGTTCTTTGTTT pLKO.1 205 CDS 100% 5.625 3.375 N CCL24 n/a
6 TRCN0000371616 CTCAAGGCAGGAGTGATCTTC pLKO_005 285 CDS 100% 4.950 2.970 N CCL24 n/a
7 TRCN0000371615 TGTCTGTGCCCACCACATCAT pLKO_005 155 CDS 100% 4.950 2.970 N CCL24 n/a
8 TRCN0000057905 CTTCTGTTCCTTGGTGTCTGT pLKO.1 141 CDS 100% 2.640 1.584 N CCL24 n/a
9 TRCN0000057906 CAGCAGGAGCACATGCCTCAA pLKO.1 269 CDS 100% 1.350 0.810 N CCL24 n/a
10 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 954 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1027 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1027 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06922 pDONR223 100% 99.7% 99.1% None 170C>T n/a
2 ccsbBroad304_06922 pLX_304 0% 99.7% 99.1% V5 170C>T n/a
3 TRCN0000469527 CCGGGTGGTCCCCTCGGAGTTTGG pLX_317 75.8% 99.7% 99.1% V5 170C>T n/a
Download CSV