Transcript: Human NM_001371262.1

Homo sapiens carboxypeptidase vitellogenic like (CPVL), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-07-03
Taxon:
Homo sapiens (human)
Gene:
CPVL (54504)
Length:
2889
CDS:
323..1753

Additional Resources:

NCBI RefSeq record:
NM_001371262.1
NBCI Gene record:
CPVL (54504)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322812 ACGATGTAGCACGGGATTTAT pLKO_005 840 CDS 100% 15.000 21.000 N CPVL n/a
2 TRCN0000322811 GTGACTTCCATCAGGTAATTA pLKO_005 1629 CDS 100% 15.000 21.000 N CPVL n/a
3 TRCN0000322809 CGGCTTCCTCACCGTGAATAA pLKO_005 547 CDS 100% 13.200 18.480 N CPVL n/a
4 TRCN0000322810 ACTACTAGATGGCGACTTAAC pLKO_005 1198 CDS 100% 10.800 15.120 N CPVL n/a
5 TRCN0000051048 CGCTCCCTATACAGAAGTGTT pLKO.1 395 CDS 100% 4.950 6.930 N CPVL n/a
6 TRCN0000051050 CGGGATTTATACAGTGCACTA pLKO.1 851 CDS 100% 4.050 5.670 N CPVL n/a
7 TRCN0000051049 GCGACTTAACAAGTGATCCTT pLKO.1 1209 CDS 100% 3.000 4.200 N CPVL n/a
8 TRCN0000322743 TGTTACAGGATGTAGTAATTA pLKO_005 1243 CDS 100% 15.000 10.500 N CPVL n/a
9 TRCN0000051052 GCCTTATGTTGTCACAAGTAA pLKO.1 697 CDS 100% 5.625 3.938 N CPVL n/a
10 TRCN0000051051 CCTGTACCAAATTGGCTTGTT pLKO.1 1078 CDS 100% 4.950 3.465 N CPVL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08388 pDONR223 100% 99.9% 99.7% None 1304C>T n/a
2 ccsbBroad304_08388 pLX_304 0% 99.9% 99.7% V5 1304C>T n/a
3 TRCN0000470442 TGTGTACTGCTGTTACGGAATCCG pLX_317 32.1% 99.9% 99.7% V5 1304C>T n/a
Download CSV