Transcript: Human NM_001371476.1

Homo sapiens calcium voltage-gated channel auxiliary subunit gamma 5 (CACNG5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CACNG5 (27091)
Length:
2001
CDS:
238..735

Additional Resources:

NCBI RefSeq record:
NM_001371476.1
NBCI Gene record:
CACNG5 (27091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045137 CGGTCAATGTTCTAAAGATGA pLKO.1 506 CDS 100% 4.950 6.930 N CACNG5 n/a
2 TRCN0000045134 GCGTTGCTTCACCATAGAATA pLKO.1 447 CDS 100% 13.200 10.560 N CACNG5 n/a
3 TRCN0000428317 CTTCATGTTCATTGGGTTTAT pLKO_005 564 CDS 100% 13.200 7.920 N CACNG5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02994 pDONR223 100% 54% 51% None (many diffs) n/a
2 ccsbBroad304_02994 pLX_304 0% 54% 51% V5 (many diffs) n/a
3 TRCN0000475930 ACAATACTGCATCTTCGATCAAAA pLX_317 34.9% 54% 51% V5 (many diffs) n/a
Download CSV