Construct: ORF TRCN0000475930
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004694.1_s317c1
- Derived from:
- ccsbBroadEn_02994
- DNA Barcode:
- ACAATACTGCATCTTCGATCAAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CACNG5 (27091)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475930
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 27091 | CACNG5 | calcium voltage-gated chann... | NM_145811.3 | 100% | 100% | |
| 2 | human | 27091 | CACNG5 | calcium voltage-gated chann... | NM_001371476.1 | 54% | 51% | (many diffs) |
| 3 | mouse | 140723 | Cacng5 | calcium channel, voltage-de... | NM_001199301.1 | 89.4% | 97% | (many diffs) |
| 4 | mouse | 140723 | Cacng5 | calcium channel, voltage-de... | NM_080644.3 | 89.4% | 97% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 894
- ORF length:
- 825
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagtgcctgc gggaggaagg ccctgaccct gctgagcagt gtctttgctg 121 tctgtggctt gggcctcctg ggtatcgcgg tcagcaccga ctactggctg tacctggagg 181 agggtgtgat tgtgccccag aaccagagca ccgagatcaa gatgtccctg cactcaggcc 241 tctggcgggt ctgcttcctt gcaggtgagg agcgggggcg ttgcttcacc atagaatatg 301 tgatgcccat gaacacccag ctgacatccg agtccacggt caatgttcta aagatgatcc 361 gctcagccac accattccct ctggtcagcc tcttcttcat gttcattggg tttatcctga 421 acaacatcgg acacatccgt ccccaccgga cgatactggc ctttgtctct ggcatcttct 481 ttatcctctc aggcctctct ctcgtggtgg gcctggtgct ctacatctcc agcatcaacg 541 atgagatgct caacaggacc aaggatgcag agacctactt caactacaag tatgggtggt 601 cgtttgccTT CGCCGCCATC TCCTTCCTTT TAACGGAGAG TGCCGGGGTG ATGTCTGTGT 661 ACCTGTTTAT GAAGCGGTAC ACCGCGGAGG ACATGTACAG GCCCCACCCT GGCTTCTACC 721 GCCCTCGGCT GAGCAACTGC TCCGATTACT CAGGCCAGTT CCTACACCCA GACGCCTGGG 781 TCAGGGGCCG CAGCCCCTCC GACATCTCCA GCGAGGCCTC CCTGCAGATG AACAGCAACT 841 ACCCCGCCTT GCTCAAGTGC CCCGACTATG ATCAGATGTC CTCTTCACCC TGCTTGCCAA 901 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 961 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1021 TATCTTGTGG AAAGGACGAA CAATACTGCA TCTTCGATCA AAAACGCGTT AAGTCgacaa 1081 tcaacctctg gattacaaaa tttgtgaaag att