Transcript: Human NM_001371658.1

Homo sapiens tRNA methyltransferase O (TRMO), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-19
Taxon:
Homo sapiens (human)
Gene:
TRMO (51531)
Length:
1671
CDS:
8..1207

Additional Resources:

NCBI RefSeq record:
NM_001371658.1
NBCI Gene record:
TRMO (51531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413193 GGATTAGAAAGAGGATCTTTA pLKO_005 189 CDS 100% 13.200 18.480 N TRMO n/a
2 TRCN0000424610 CACTTTAGAAGTGCGGTTTAC pLKO_005 1012 CDS 100% 10.800 15.120 N TRMO n/a
3 TRCN0000141218 CGTACTAGACATCAAGCCCTA pLKO.1 463 CDS 100% 2.160 1.728 N TRMO n/a
4 TRCN0000144999 GAGCCTTTAGCAGACTTTAAT pLKO.1 518 CDS 100% 15.000 10.500 N TRMO n/a
5 TRCN0000426982 GGTAGAAGGTGGAGCTATATA pLKO_005 409 CDS 100% 15.000 10.500 N TRMO n/a
6 TRCN0000142163 GCCCTACATAGCTGAGTATGA pLKO.1 478 CDS 100% 4.950 3.465 N TRMO n/a
7 TRCN0000142628 CCACCATAGCACTAAGAGGAA pLKO.1 640 CDS 100% 2.640 1.848 N TRMO n/a
8 TRCN0000143077 CAGAAGAACAAATTGGCCCAT pLKO.1 807 CDS 100% 2.160 1.512 N TRMO n/a
9 TRCN0000142309 GAACATTCCTTGATGGGCCTA pLKO.1 218 CDS 100% 2.160 1.512 N TRMO n/a
10 TRCN0000122850 GCAGAAGAACAAATTGGCCCA pLKO.1 806 CDS 100% 0.540 0.378 N TRMO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08308 pDONR223 100% 86.3% 81.6% None (many diffs) n/a
2 ccsbBroad304_08308 pLX_304 0% 86.3% 81.6% V5 (many diffs) n/a
3 TRCN0000473753 ATGCAATAGCTATTGGGGTATACC pLX_317 41.1% 86.3% 81.6% V5 (many diffs) n/a
Download CSV