Transcript: Human NM_001371772.1

Homo sapiens adenylate kinase 8 (AK8), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
AK8 (158067)
Length:
1444
CDS:
30..1334

Additional Resources:

NCBI RefSeq record:
NM_001371772.1
NBCI Gene record:
AK8 (158067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358967 CAAAGCAACCATCGTACTAAT pLKO_005 666 CDS 100% 13.200 18.480 N AK8 n/a
2 TRCN0000358966 CATCGAGAGTGGGATCATTAA pLKO_005 1289 CDS 100% 13.200 18.480 N AK8 n/a
3 TRCN0000078680 CCCTCAAACTGGAGAGATTTA pLKO.1 437 CDS 100% 13.200 9.240 N AK8 n/a
4 TRCN0000359047 TCACACCCAGACACGTCATTG pLKO_005 361 CDS 100% 10.800 7.560 N AK8 n/a
5 TRCN0000078682 CTGACTCTGAGAAGAATTGAT pLKO.1 1059 CDS 100% 5.625 3.938 N AK8 n/a
6 TRCN0000078678 GCTGACTTGGAGCAGTTGTAT pLKO.1 1215 CDS 100% 5.625 3.938 N AK8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05092 pDONR223 100% 90.6% 90.6% None 84_85ins135 n/a
2 ccsbBroad304_05092 pLX_304 0% 90.6% 90.6% V5 84_85ins135 n/a
3 ccsbBroadEn_15271 pDONR223 0% 90.6% 90.6% None 84_85ins135 n/a
4 ccsbBroad304_15271 pLX_304 0% 90.6% 90.6% V5 84_85ins135 n/a
5 TRCN0000480307 CCATCGTTTCGTGATACCTGTAGT pLX_317 30.2% 90.6% 90.6% V5 (not translated due to frame shift) 84_85ins135 n/a
Download CSV