Construct: ORF TRCN0000480307
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002406.2_s317c1
- Derived from:
- ccsbBroadEn_15271
- DNA Barcode:
- CCATCGTTTCGTGATACCTGTAGT
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AK8 (158067)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480307
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 158067 | AK8 | adenylate kinase 8 | NM_152572.3 | 100% | 100% | |
2 | human | 158067 | AK8 | adenylate kinase 8 | XM_005272169.2 | 97.5% | 97.5% | 82_117del |
3 | human | 158067 | AK8 | adenylate kinase 8 | NM_001371771.1 | 93.9% | 93.9% | 0_1ins87 |
4 | human | 158067 | AK8 | adenylate kinase 8 | NM_001371772.1 | 90.6% | 90.6% | 84_85ins135 |
5 | human | 158067 | AK8 | adenylate kinase 8 | XM_006716965.2 | 84.8% | 84.7% | 0_1ins216;3G>A |
6 | human | 158067 | AK8 | adenylate kinase 8 | XM_011518278.2 | 84.5% | 84.5% | 0_1ins222 |
7 | human | 158067 | AK8 | adenylate kinase 8 | XR_929719.2 | 78.6% | (many diffs) | |
8 | human | 158067 | AK8 | adenylate kinase 8 | XM_011518277.2 | 71.2% | 66.7% | (many diffs) |
9 | human | 158067 | AK8 | adenylate kinase 8 | NM_001317959.2 | 63.4% | 60% | (many diffs) |
10 | human | 158067 | AK8 | adenylate kinase 8 | XM_017014308.1 | 63.4% | 60% | (many diffs) |
11 | human | 158067 | AK8 | adenylate kinase 8 | NM_001317958.2 | 57.4% | 57.4% | 0_1ins612 |
12 | human | 158067 | AK8 | adenylate kinase 8 | NM_001371773.1 | 57.4% | 57.4% | 0_1ins612 |
13 | human | 158067 | AK8 | adenylate kinase 8 | NM_001371774.1 | 57.4% | 57.4% | 0_1ins612 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1503
- ORF length:
- 1437
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cgccactatc gccccgcacc gtatcccccc cgagatgccc cagtacgggg 121 aggagaacca catcttcgag ttgatgcaga acatgctgga gcaactcctg atccaccagc 181 ccgaagatcc catccccttc atgatccagc acttgcatag agacaacgac aatgtgccca 241 ggattgtaat attaggtcca cccgcctcag ggaaaacaac aatagcaatg tggctctgca 301 aacatctgaa cagcagtctc ctcaccctgg agaacctgat cttaaatgag ttttcctata 361 cggccaccga agccagaagg ctttatctgc aaaggaagac agttcccagc gcgctgctcg 421 tccagctgat tcaggaacgc ctggctgaag aggattgcat caagcagggc tggattctgg 481 atggcatccc tgagacgcgt gagcaggctc tgaggatcca gaccctgggg atcacaccca 541 gacacgtcat tgtgctgagt gctccagaca cggtcctgat cgagagaaac ttggggaaga 601 gaatcgaccc tcaaactgga gagatttatc acaccacctt tgactggcca cccgaatctg 661 aaatccagaa ccgtctcatg gtgccagagg acatctcaga gctggagacg gctcagaaac 721 tgctggagta tcataggaac atcgtcaggg tcattccctc ctaccccaaa atcctcaaag 781 tcatcagtgc tgaccagcca tgtgtggacg tcttctacca ggctctgacc tatgtccaaa 841 gcaaccatcg tactaatgcc ccgttcaccc cgagggtgct gctgctcggg cctgtgggca 901 gtgggaaaag tctgcaggcc gccctcctgg cccagaaata caggcttgtc aatgtctgct 961 gtgggcaact gctgaaagag gctgtggcag ataggaccac gtttggcgag ctcatccagc 1021 ccttctttga aaaggagatg gcagttcctg acagcctcct catgaaggtg cTGAGCCAGC 1081 GCCTGGACCA GCAGGACTGC ATCCAGAAAG GCTGGGTGCT ACACGGCGTC CCGCGGGACC 1141 TCGACCAGGC ACACCTGCTG AACCGCCTGG GCTACAATCC CAACAGGGTG TTTTTCCTGA 1201 ATGTGCCATT TGATTCCATC ATGGAGCGGC TGACTCTGAG AAGAATTGAT CCAGTCACTG 1261 GGGAAAGGTA CCACCTCATG TACAAGCCAC CTCCCACCAT GGAGATCCAG GCTCGCCTCC 1321 TGCAGAACCC AAAGGATGCT GAAGAGCAGG TCAAGCTGAA AATGGACCTG TTCTACAGGA 1381 ACTCAGCTGA CTTGGAGCAG TTGTATGGGT CGGCCATCAC CCTCAATGGG GACCAGGACC 1441 CATACACAGT CTTCGAATAC ATCGAGAGTG GGATCATTAA TCCCCTGCCC AAGAAAATCC 1501 CCTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT 1561 CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG 1621 GCTTTATATA TCTTGTGGAA AGGACGACCA TCGTTTCGTG ATACCTGTAG TACGCGTTAA 1681 GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t