Transcript: Human NM_001372163.1

Homo sapiens proline rich and Gla domain 3 (PRRG3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PRRG3 (79057)
Length:
5705
CDS:
119..814

Additional Resources:

NCBI RefSeq record:
NM_001372163.1
NBCI Gene record:
PRRG3 (79057)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001372163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420565 TGACAAGTAGTGGGACGTTTG pLKO_005 805 CDS 100% 6.000 8.400 N PRRG3 n/a
2 TRCN0000427998 CCAAAGTACGAGGAGATAGTG pLKO_005 767 CDS 100% 4.950 6.930 N PRRG3 n/a
3 TRCN0000055835 CCATTCGGTCCTGAAACGATT pLKO.1 148 CDS 100% 4.950 6.930 N PRRG3 n/a
4 TRCN0000055833 GCTGATTGTCATCGCCTTGTT pLKO.1 391 CDS 100% 4.950 6.930 N PRRG3 n/a
5 TRCN0000055836 GCTAGAGAGCACCCTCTACCT pLKO.1 628 CDS 100% 0.088 0.070 N PRRG3 n/a
6 TRCN0000055834 CAGAGCTCAGATGCCATGTAT pLKO.1 341 CDS 100% 5.625 3.938 N PRRG3 n/a
7 TRCN0000055837 AGCGTGTCTTACAGTGACCCA pLKO.1 743 CDS 100% 0.660 0.462 N PRRG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001372163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08914 pDONR223 100% 99.8% 99.5% None 458A>G n/a
2 ccsbBroad304_08914 pLX_304 0% 99.8% 99.5% V5 458A>G n/a
3 TRCN0000480098 AACAACTCCGTTTAAACTAGGCGA pLX_317 50.5% 99.8% 99.5% V5 458A>G n/a
Download CSV