Transcript: Mouse NM_001372258.1

Mus musculus repulsive guidance molecule family member B (Rgmb), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Mus musculus (mouse)
Gene:
Rgmb (68799)
Length:
4481
CDS:
564..1997

Additional Resources:

NCBI RefSeq record:
NM_001372258.1
NBCI Gene record:
Rgmb (68799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001372258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193667 CTATTTCCAATCGTGTGTCTT pLKO.1 1796 CDS 100% 4.950 3.960 N Rgmb n/a
2 TRCN0000175836 GACAACAATTACCTTTCGGTT pLKO.1 1266 CDS 100% 2.640 2.112 N Rgmb n/a
3 TRCN0000370437 CCACTGGTGATGCCAACTTTA pLKO_005 1828 CDS 100% 13.200 9.240 N RGMB n/a
4 TRCN0000173925 GCTGTGTTAGGCATCAGTGAT pLKO.1 1017 CDS 100% 4.950 3.465 N Rgmb n/a
5 TRCN0000173187 CCTTCGAACTTTCAAGGATCA pLKO.1 1205 CDS 100% 4.050 2.835 N Rgmb n/a
6 TRCN0000093081 GATGAGGAAGAGGAGGAAGAA pLKO.1 566 CDS 100% 4.950 2.475 Y Gm5518 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001372258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09984 pDONR223 100% 87% 87.7% None (many diffs) n/a
2 ccsbBroad304_09984 pLX_304 0% 87% 87.7% V5 (many diffs) n/a
3 TRCN0000477953 TTTCAAATGTTACTTCTATTTTGT pLX_317 28.8% 87% 87.7% V5 (many diffs) n/a
Download CSV