Construct: ORF TRCN0000477953
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000718.1_s317c1
- Derived from:
- ccsbBroadEn_09984
- DNA Barcode:
- TTTCAAATGTTACTTCTATTTTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RGMB (285704)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477953
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 285704 | RGMB | repulsive guidance molecule... | NM_001012761.3 | 99.7% | 99.5% | 177G>A;187A>C;797A>G |
2 | human | 285704 | RGMB | repulsive guidance molecule... | NM_001366509.1 | 99.7% | 99.5% | 177G>A;187A>C;797A>G |
3 | human | 285704 | RGMB | repulsive guidance molecule... | NM_001366510.1 | 99.7% | 99.5% | 177G>A;187A>C;797A>G |
4 | human | 285704 | RGMB | repulsive guidance molecule... | XM_011543345.2 | 99.7% | 99.5% | 177G>A;187A>C;797A>G |
5 | human | 285704 | RGMB | repulsive guidance molecule... | NM_001366511.1 | 99.5% | 98.9% | (many diffs) |
6 | human | 285704 | RGMB | repulsive guidance molecule... | NM_001366508.1 | 91.2% | 91% | (many diffs) |
7 | human | 285704 | RGMB | repulsive guidance molecule... | XM_011543346.2 | 82.3% | 82% | (many diffs) |
8 | human | 285704 | RGMB | repulsive guidance molecule... | XM_011543347.3 | 55.3% | 54.3% | (many diffs) |
9 | mouse | 68799 | Rgmb | repulsive guidance molecule... | NM_001372256.1 | 87% | 87.7% | (many diffs) |
10 | mouse | 68799 | Rgmb | repulsive guidance molecule... | NM_001372257.1 | 87% | 87.7% | (many diffs) |
11 | mouse | 68799 | Rgmb | repulsive guidance molecule... | NM_001372258.1 | 87% | 87.7% | (many diffs) |
12 | mouse | 68799 | Rgmb | repulsive guidance molecule... | NM_001372259.1 | 79.5% | 81.2% | (many diffs) |
13 | mouse | 68799 | Rgmb | repulsive guidance molecule... | NM_178615.4 | 79.5% | 81.2% | (many diffs) |
14 | mouse | 68799 | Rgmb | repulsive guidance molecule... | NM_001372292.1 | 41.3% | 40.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1500
- ORF length:
- 1434
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat aaggaagaag aggaagcgaa gcgcgccccc cggcccatgc cgcagccacg 121 ggcccagacc cgccacggcg cccgcgccgc cgccctcgcc ggagcccacg agacctgcat 181 ggacgggcat gggcttgaga gcagcacctt ccagcgccgc cgctgccgcc gccgaggttg 241 aacagcgccg ccgccccggg ctctgccccc cgccgctgga gctgctgctg ctgctgctgt 301 tcagcctcgg gctgctccac gcaggtgact gccaacagcc agcccaatgt cgaatccaga 361 aatgcaccac ggacttcgtg tccctgactt ctcacctgaa ctctgccgtt gacggctttg 421 actctgagtt ttgcaaggcc ttgcgtgcct atgctggctg cacccagcga acttcaaaag 481 cctgccgtgg caacctggta taccattctg ccgtgttggg tatcagtgac ctcatgagcc 541 agaggaattg ttccaaggat ggacccacat cctctaccaa ccccgaagtg acccatgatc 601 cttgcaacta tcacagccac gctggagcca gggaacacag gagaggggac cagaaccctc 661 ccagttacct tttttgtggc ttgtttggag atcctcacct cagaactttc aaggataact 721 tccaaacatg caaagtagaa ggggcctggc cactcataga taataattat ctttcagttc 781 aagtgacaaa cgtacctgtg gtccctggat ccagtgctac tgctacaaat aagatcacta 841 ttatcttcaa agcccaccat gggtgtacag atcagaaagt ctaccaagct gtgacagatg 901 acctgccggc cgcctttgtg gatggcacca ccagtggtgg ggacagcgat gccaagagcc 961 tgcgtatcgt ggaaagggag agtggccact atgtggagat gcacgcccgc tatataggga 1021 ccacagtgtt tgtgcggcag gtgggtcgct acctgaccct tgccatccgt atgcctgaag 1081 acctggccat gTCCTACGAG GAGAGCCAGG ACCTGCAGCT GTGCGTGAAC GGCTGCCCCC 1141 TGAGTGAACG CATCGATGAC GGGCAGGGCC AGGTGTCTGC CATCCTGGGA CACAGCCTGC 1201 CTCGCACCTC CTTGGTGCAG GCCTGGCCTG GCTACACACT GGAGACTGCC AACACTCAAT 1261 GCCATGAGAA GATGCCAGTG AAGGACATCT ATTTCCAGTC CTGTGTCTTC GACCTGCTCA 1321 CCACTGGTGA TGCCAACTTT ACTGCCGCAG CCCACAGTGC CTTGGAGGAT GTGGAGGCCC 1381 TGCACCCAAG GAAGGAACGC TGGCACATTT TCCCCAGCAG TGGCAATGGG ACTCCCCGTG 1441 GAGGCAGTGA TTTGTCTGTC AGTCTAGGAC TCACCTGCTT GATCCTTATC GTGTTTTTGT 1501 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1561 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1621 TTTATATATC TTGTGGAAAG GACGATTTCA AATGTTACTT CTATTTTGTA CGCGTTAAGT 1681 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt