Transcript: Human NM_001374325.1

Homo sapiens F-box protein 11 (FBXO11), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
FBXO11 (80204)
Length:
3996
CDS:
267..2798

Additional Resources:

NCBI RefSeq record:
NM_001374325.1
NBCI Gene record:
FBXO11 (80204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273373 ATCATGGAAACCCAATTATTA pLKO_005 1333 CDS 100% 15.000 21.000 N FBXO11 n/a
2 TRCN0000273428 GTAAATTGTAGCCCTATTATT pLKO_005 1116 CDS 100% 15.000 21.000 N FBXO11 n/a
3 TRCN0000284969 ATCATGGCATGGGTTACTTTG pLKO_005 1402 CDS 100% 10.800 15.120 N FBXO11 n/a
4 TRCN0000004302 GCAGTATGTGTTAGTGGTCAA pLKO.1 1176 CDS 100% 4.050 5.670 N FBXO11 n/a
5 TRCN0000273372 AGATGCTTATGTTGGATATAT pLKO_005 1025 CDS 100% 15.000 12.000 N FBXO11 n/a
6 TRCN0000382237 GATCATGCACAGGGAATATAT pLKO_005 1263 CDS 100% 15.000 10.500 N FBXO11 n/a
7 TRCN0000381455 TTGTCCAATTGTTCGGCATAA pLKO_005 1754 CDS 100% 10.800 7.560 N FBXO11 n/a
8 TRCN0000004304 GAGAGTTTCCAGCAGTTGTAT pLKO.1 714 CDS 100% 5.625 3.938 N FBXO11 n/a
9 TRCN0000004303 GAGTGCTAGAAGACAATGATA pLKO.1 1966 CDS 100% 5.625 3.938 N FBXO11 n/a
10 TRCN0000273371 GAGTGCTAGAAGACAATGATA pLKO_005 1966 CDS 100% 5.625 3.938 N FBXO11 n/a
11 TRCN0000004300 CAAGGAGTAATAGAAGAGAAT pLKO.1 1824 CDS 100% 4.950 3.465 N FBXO11 n/a
12 TRCN0000004301 CGCCTCAACTTCAACTACAGA pLKO.1 377 CDS 100% 3.000 2.100 N FBXO11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04189 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04189 pLX_304 24.8% 100% 100% V5 n/a
3 TRCN0000473337 GAGGTAATGCAAATGACGCTGTGC pLX_317 19.6% 100% 100% V5 n/a
Download CSV