Transcript: Human NM_001374386.1

Homo sapiens ATPase phospholipid transporting 8B1 (ATP8B1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
ATP8B1 (5205)
Length:
6063
CDS:
396..4001

Additional Resources:

NCBI RefSeq record:
NM_001374386.1
NBCI Gene record:
ATP8B1 (5205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412343 CATCGAATGAATCCTACTAAG pLKO_005 2133 CDS 100% 10.800 15.120 N ATP8B1 n/a
2 TRCN0000050124 CGGAAGCGAATGTCTATCATT pLKO.1 2043 CDS 100% 5.625 7.875 N ATP8B1 n/a
3 TRCN0000050127 CCACTATCTTATTGAGCAAAT pLKO.1 1772 CDS 100% 10.800 8.640 N ATP8B1 n/a
4 TRCN0000050123 GCCATCAGAAAGTGATAAGAT pLKO.1 3758 CDS 100% 5.625 4.500 N ATP8B1 n/a
5 TRCN0000419044 AGCTCGGGCAGATCCATTATA pLKO_005 1576 CDS 100% 15.000 10.500 N ATP8B1 n/a
6 TRCN0000421818 TTAAGAGAGCAGCCAATTTAT pLKO_005 592 CDS 100% 15.000 10.500 N ATP8B1 n/a
7 TRCN0000426154 ACAATAGCAGAGCCAAGAAAT pLKO_005 4158 3UTR 100% 13.200 9.240 N ATP8B1 n/a
8 TRCN0000050125 GCTCTTGTAATAACAGTCAAT pLKO.1 3480 CDS 100% 4.950 3.465 N ATP8B1 n/a
9 TRCN0000050126 CCGATGGTCTTACATAAGGAT pLKO.1 3065 CDS 100% 3.000 2.100 N ATP8B1 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4301 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4298 3UTR 100% 4.950 2.475 Y LOC339059 n/a
12 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4561 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4561 3UTR 100% 4.050 2.025 Y ORAI2 n/a
14 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4561 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.