Transcript: Human NM_001385.3

Homo sapiens dihydropyrimidinase (DPYS), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
DPYS (1807)
Length:
2122
CDS:
136..1695

Additional Resources:

NCBI RefSeq record:
NM_001385.3
NBCI Gene record:
DPYS (1807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414308 AGATCGGATGTCCGTAATATG pLKO_005 1194 CDS 100% 13.200 18.480 N DPYS n/a
2 TRCN0000435308 TGTGGAGCGTGCACCCTATAA pLKO_005 1596 CDS 100% 13.200 18.480 N DPYS n/a
3 TRCN0000433366 TCAACTCCCTAGGATCCTTTA pLKO_005 1788 3UTR 100% 10.800 15.120 N DPYS n/a
4 TRCN0000046743 CAAGATGTTTATGGCCTATAA pLKO.1 609 CDS 100% 13.200 9.240 N DPYS n/a
5 TRCN0000046745 CACCACCATGATTATTGATTT pLKO.1 417 CDS 100% 13.200 9.240 N DPYS n/a
6 TRCN0000046747 TGTGGCAGTTACCAGCACAAA pLKO.1 1257 CDS 100% 4.950 3.465 N DPYS n/a
7 TRCN0000046744 CTAATGATGATCTAACCACAA pLKO.1 1082 CDS 100% 4.050 2.835 N DPYS n/a
8 TRCN0000046746 GTGACTATTTCAAGAGGCAAA pLKO.1 1450 CDS 100% 4.050 2.835 N DPYS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00460 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00460 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472173 GGCGCAGTCATACATCTACTTTAC pLX_317 31.3% 100% 100% V5 n/a
Download CSV