Transcript: Human NM_001415.4

Homo sapiens eukaryotic translation initiation factor 2 subunit gamma (EIF2S3), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
EIF2S3 (1968)
Length:
3457
CDS:
14..1432

Additional Resources:

NCBI RefSeq record:
NM_001415.4
NBCI Gene record:
EIF2S3 (1968)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001415.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323184 GACTGAAGAATACCAGTTAAA pLKO_005 1427 CDS 100% 13.200 7.920 N EIF2S3 n/a
2 TRCN0000136135 GCATTTGTCCAAGGTACAGTA pLKO.1 638 CDS 100% 4.950 2.970 N EIF2S3 n/a
3 TRCN0000323109 GCATTTGTCCAAGGTACAGTA pLKO_005 638 CDS 100% 4.950 2.970 N EIF2S3 n/a
4 TRCN0000323185 ACTGTCCTGGCCACGATATTT pLKO_005 414 CDS 100% 15.000 7.500 Y EIF2S3 n/a
5 TRCN0000323110 GCCACTTTCACACGAAGTTAT pLKO_005 100 CDS 100% 13.200 6.600 Y EIF2S3 n/a
6 TRCN0000323186 GTAGGTAACGGTAAGGTTATT pLKO_005 1550 3UTR 100% 13.200 6.600 Y EIF2S3 n/a
7 TRCN0000134835 CCCGGCTTATTGTTATTAGAT pLKO.1 774 CDS 100% 5.625 2.813 Y EIF2S3 n/a
8 TRCN0000138462 CCCTTAGCCGAAGAGTTGAAA pLKO.1 1338 CDS 100% 5.625 2.813 Y EIF2S3 n/a
9 TRCN0000136243 GAAGTGCTCATGGTGAACATA pLKO.1 1217 CDS 100% 5.625 2.813 Y EIF2S3 n/a
10 TRCN0000136436 CGGAGCATAATGATCTGCAAT pLKO.1 981 CDS 100% 4.950 2.475 Y EIF2S3 n/a
11 TRCN0000136286 GCTGTGAAGTTGATGACCTTA pLKO.1 816 CDS 100% 4.950 2.475 Y EIF2S3 n/a
12 TRCN0000134505 GCTTGGATATGCTAATGCTAA pLKO.1 253 CDS 100% 4.950 2.475 Y EIF2S3 n/a
13 TRCN0000134754 GTCTAAGAATGAAGTGCTCAT pLKO.1 1207 CDS 100% 4.050 2.025 Y EIF2S3 n/a
14 TRCN0000138816 GAGGAGTGACAATCAAGCCAA pLKO.1 1395 CDS 100% 2.640 1.320 Y EIF2S3 n/a
15 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 2928 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001415.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13849 pDONR223 100% 99.8% 98.3% None 588A>T;1398delG n/a
2 ccsbBroad304_13849 pLX_304 0% 99.8% 98.3% V5 (not translated due to prior stop codon) 588A>T;1398delG n/a
3 TRCN0000467776 TCATTTAGTGTGGCCCTGCCGTAC pLX_317 33.8% 99.8% 98.3% V5 (not translated due to prior stop codon) 588A>T;1398delG n/a
Download CSV