Construct: ORF TRCN0000467776
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005152.1_s317c1
- Derived from:
- ccsbBroadEn_13849
- DNA Barcode:
- TCATTTAGTGTGGCCCTGCCGTAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- EIF2S3 (1968)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467776
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1968 | EIF2S3 | eukaryotic translation init... | NM_001415.4 | 99.8% | 98.3% | 588A>T;1398delG |
| 2 | human | 255308 | EIF2S3B | eukaryotic translation init... | NM_001357734.1 | 98% | 96.8% | (many diffs) |
| 3 | human | 255308 | EIF2S3B | eukaryotic translation init... | NM_001357731.1 | 92.6% | 91.5% | (many diffs) |
| 4 | mouse | 26905 | Eif2s3x | eukaryotic translation init... | NM_012010.3 | 90.7% | 97.8% | (many diffs) |
| 5 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | NM_012011.1 | 89.1% | 96.6% | (many diffs) |
| 6 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XM_006531608.3 | 85.7% | 93.6% | (many diffs) |
| 7 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XM_011248593.1 | 85.7% | 93.6% | (many diffs) |
| 8 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XR_879402.2 | 75.4% | (many diffs) | |
| 9 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XR_001782886.1 | 66.2% | (many diffs) | |
| 10 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XR_001782885.1 | 66% | (many diffs) | |
| 11 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XR_388245.1 | 61.8% | (many diffs) | |
| 12 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XR_001782884.1 | 58% | (many diffs) | |
| 13 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XM_006531609.1 | 55.3% | 59.9% | (many diffs) |
| 14 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XM_006531610.3 | 55.3% | 59.9% | (many diffs) |
| 15 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XR_001782883.1 | 54.8% | (many diffs) | |
| 16 | mouse | 26908 | Eif2s3y | eukaryotic translation init... | XR_001782887.1 | 51.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1470
- ORF length:
- 1404
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gggcggagaa gctggagtga ctctagggca gccgcatctt tcgcgtcagg 121 atctcaccac cttggatgtt accaagttga cgccactttc acacgaagtt atcagcagac 181 aagccacaat taacataggt acaattggtc atgtagctca tgggaaatcc acagtcgtca 241 aagctatttc tggagttcat actgtcaggt tcaaaaatga actagaaaga aatattacaa 301 tcaagcttgg atatgctaat gctaagattt ataagcttga tgacccaagt tgccctcggc 361 cagaatgtta tagatcttgt gggagcagta cacctgacga gtttcctacg gacattccag 421 ggaccaaagg gaacttcaaa ttagtcagac atgtttcctt tgttgactgt cctggccacg 481 atattttgat ggctactatg ctgaacggtg cagcagtgat ggatgcagct cttctgttga 541 tagctggtaa tgaatcttgc cctcagcctc agacatcgga acacctggct gctatagaga 601 tcatgaaact gaagcatatt ttgattctac aaaataaaat tgatttggta aatgaaagtc 661 aggctaaaga acaatacgag cagatccttg catttgtcca aggtacagta gcagagggag 721 ctcccattat tccaatttca gctcagctga aatacaatat tgaagttgtt tgtgagtaca 781 tagtaaagaa aattccagta cccccaagag actttacttc agagccccgg cttattgtta 841 ttagatcttt tgatgtcaac aaacctggct gtgaagttga tgaccttaag ggaggtgtag 901 ctggtggtag tatcctaaaa ggagtattaa aggtgggcca ggagatagaa gtaagacctg 961 gtattgtttc caaagatagt gaaggaaaac tcatgtgtaa accaaTCTTT TCCAAAATTG 1021 TATCACTTTT TGCGGAGCAT AATGATCTGC AATATGCTGC TCCAGGCGGT CTTATTGGAG 1081 TTGGAACAAA AATTGACCCC ACTTTGTGCC GGGCTGACAG AATGGTGGGG CAAGTACTTG 1141 GTGCAGTCGG AGCTTTACCT GAGATATTCA CAGAATTGGA AATTTCCTAT TTCCTGCTTA 1201 GACGGCTTCT AGGTGTACGC ACTGAAGGAG ACAAGAAAGC AGCAAAGGTT CAAAAGCTGT 1261 CTAAGAATGA AGTGCTCATG GTGAACATAG GATCCCTGTC AACAGGAGGG AGAGTTAGTG 1321 CTGTCAAGGC CGATTTGGGT AAAATTGTTT TGACCAATCC AGTGTGCACA GAGGTAGGAG 1381 AAAAAATTGC CCTTAGCCGA AGAGTTGAAA AACACTGGCG TTTAATTGGT TGGGGTCAGA 1441 TAAGAAGAGG AGTGACAATC AACCAACAGT AGATGATGAC TGCCCAACTT TCTTGTACAA 1501 AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA 1561 ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA 1621 GGACGATCAT TTAGTGTGGC CCTGCCGTAC ACGCGTTAAG TCgacaatca acctctggat 1681 tacaaaattt gtgaaagatt