Transcript: Human NM_001418.4

Homo sapiens eukaryotic translation initiation factor 4 gamma 2 (EIF4G2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
EIF4G2 (1982)
Length:
3794
CDS:
309..3032

Additional Resources:

NCBI RefSeq record:
NM_001418.4
NBCI Gene record:
EIF4G2 (1982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276485 ATGGGACGTCATCGTTCAAAT pLKO_005 1500 CDS 100% 13.200 18.480 N EIF4G2 n/a
2 TRCN0000150297 CCCTTTGGTGAAATCCTATTT pLKO.1 2216 CDS 100% 13.200 9.240 N EIF4G2 n/a
3 TRCN0000276484 CCCTTTGGTGAAATCCTATTT pLKO_005 2216 CDS 100% 13.200 9.240 N EIF4G2 n/a
4 TRCN0000276423 ATGGACCAAAGACGATCAATC pLKO_005 1261 CDS 100% 10.800 7.560 N EIF4G2 n/a
5 TRCN0000147956 GTGCTCCTTGATGTTAAGTAA pLKO.1 1151 CDS 100% 5.625 3.938 N EIF4G2 n/a
6 TRCN0000285569 GTGCTCCTTGATGTTAAGTAA pLKO_005 1151 CDS 100% 5.625 3.938 N EIF4G2 n/a
7 TRCN0000149981 CCAAAGTATAGCTCACTGTAT pLKO.1 684 CDS 100% 4.950 3.465 N EIF4G2 n/a
8 TRCN0000146323 CCAAAGCCTTAAATTGTGCAA pLKO.1 3041 3UTR 100% 2.640 1.848 N EIF4G2 n/a
9 TRCN0000147914 GCAACACTGAATACTGTAGAA pLKO.1 3371 3UTR 100% 4.950 2.970 N EIF4G2 n/a
10 TRCN0000276424 GCAACACTGAATACTGTAGAA pLKO_005 3371 3UTR 100% 4.950 2.970 N EIF4G2 n/a
11 TRCN0000009807 GCAGCAAACAACTCCGCAAAT pLKO.1 495 CDS 100% 10.800 7.560 N Eif4g2 n/a
12 TRCN0000278104 GCAGCAAACAACTCCGCAAAT pLKO_005 495 CDS 100% 10.800 7.560 N Eif4g2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.