Transcript: Human NM_001422.4

Homo sapiens E74 like ETS transcription factor 5 (ELF5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ELF5 (2001)
Length:
2317
CDS:
123..890

Additional Resources:

NCBI RefSeq record:
NM_001422.4
NBCI Gene record:
ELF5 (2001)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001422.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436380 AGTTCTCATCTATGGGAATTT pLKO_005 606 CDS 100% 13.200 10.560 N ELF5 n/a
2 TRCN0000423491 ATGATTAGTTTGCAGGTTATG pLKO_005 1307 3UTR 100% 10.800 8.640 N ELF5 n/a
3 TRCN0000013874 GCCCTGAGATACTACTATAAA pLKO.1 786 CDS 100% 15.000 10.500 N ELF5 n/a
4 TRCN0000431832 GACATTCGAAAGGCTTCATTT pLKO_005 954 3UTR 100% 13.200 9.240 N ELF5 n/a
5 TRCN0000013873 GCTGGGACTTAATTGGATTTA pLKO.1 1576 3UTR 100% 13.200 9.240 N ELF5 n/a
6 TRCN0000013875 GCTGATTCCAACTGCTTGAAA pLKO.1 531 CDS 100% 5.625 3.938 N ELF5 n/a
7 TRCN0000013876 CCACCCTGAATACTGGACTAA pLKO.1 269 CDS 100% 4.950 3.465 N ELF5 n/a
8 TRCN0000013877 CCTGTGACTCATACTGGACAT pLKO.1 244 CDS 100% 4.050 2.835 N ELF5 n/a
9 TRCN0000417902 TTTGTGGTGTCTTGATCAAAC pLKO_005 1125 3UTR 100% 10.800 6.480 N ELF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001422.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00497 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00497 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470383 GCAAAGGTCACAGATGCCTCTAAT pLX_317 59.7% 100% 100% V5 n/a
Download CSV