Transcript: Human NM_001459.4

Homo sapiens fms related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
FLT3LG (2323)
Length:
1050
CDS:
105..812

Additional Resources:

NCBI RefSeq record:
NM_001459.4
NBCI Gene record:
FLT3LG (2323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001459.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052604 CTGTCTGACTACCTGCTTCAA pLKO.1 246 CDS 100% 4.950 6.930 N FLT3LG n/a
2 TRCN0000378687 TCCTCCGACTTCGCTGTCAAA pLKO_005 216 CDS 100% 4.950 6.930 N FLT3LG n/a
3 TRCN0000052606 CGGAGATACACTTTGTCACCA pLKO.1 412 CDS 100% 2.640 3.696 N FLT3LG n/a
4 TRCN0000372328 GCTTCGTCCAGACCAACATCT pLKO_005 466 CDS 100% 4.950 3.465 N FLT3LG n/a
5 TRCN0000052603 CATAGCCTGGACACAGAGGAA pLKO.1 880 3UTR 100% 2.640 1.848 N FLT3LG n/a
6 TRCN0000174213 CATAGCCTGGACACAGAGGAA pLKO.1 880 3UTR 100% 2.640 1.848 N FLT3LG n/a
7 TRCN0000372329 TGGGTCCAAGATGCAAGGCTT pLKO_005 374 CDS 100% 2.640 1.848 N FLT3LG n/a
8 TRCN0000052607 CCTGCTTCAAGATTACCCAGT pLKO.1 257 CDS 100% 2.160 1.512 N FLT3LG n/a
9 TRCN0000052605 GCCCTGGATCACTCGCCAGAA pLKO.1 530 CDS 100% 0.000 0.000 N FLT3LG n/a
10 TRCN0000372270 AGGACTGCTCCTTCCAACACA pLKO_005 187 CDS 100% 3.000 1.800 N FLT3LG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001459.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.