Transcript: Human NM_001465.6

Homo sapiens FYN binding protein 1 (FYB1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
FYB1 (2533)
Length:
4829
CDS:
149..2638

Additional Resources:

NCBI RefSeq record:
NM_001465.6
NBCI Gene record:
FYB1 (2533)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001465.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158759 GATGACATTTATGATGGGATT pLKO.1 2012 CDS 100% 4.050 5.670 N FYB1 n/a
2 TRCN0000159217 CAGAAACATTAAACCTCCGTT pLKO.1 1411 CDS 100% 2.640 2.112 N FYB1 n/a
3 TRCN0000161284 GCCATCTCTTCACAGTGTAAA pLKO.1 556 CDS 100% 13.200 9.240 N FYB1 n/a
4 TRCN0000161163 GCCCTTCTCTAACAGTACATA pLKO.1 3619 3UTR 100% 5.625 3.938 N FYB1 n/a
5 TRCN0000159833 GCTGTAGAGATTGACTATGAT pLKO.1 1844 CDS 100% 5.625 3.938 N FYB1 n/a
6 TRCN0000161805 CCAAATGTTGACCTGACGAAA pLKO.1 1238 CDS 100% 4.950 3.465 N FYB1 n/a
7 TRCN0000159872 GAAGTTATACAAACCACAGAT pLKO.1 2492 CDS 100% 4.950 3.465 N FYB1 n/a
8 TRCN0000165316 GCTTCAAGCAAGGAGAGCAAA pLKO.1 1737 CDS 100% 4.950 3.465 N FYB1 n/a
9 TRCN0000159548 CCAAGATTAGATGCCACTAAT pLKO.1 4220 3UTR 100% 1.320 0.924 N FYB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001465.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06233 pDONR223 100% 99.9% 99.8% None 2152G>T n/a
2 ccsbBroad304_06233 pLX_304 0% 99.9% 99.8% V5 2152G>T n/a
3 TRCN0000466407 CACCGCCTGACGTTCTTTGTTAAC pLX_317 15.6% 99.9% 99.8% V5 2152G>T n/a
Download CSV