Transcript: Human NM_001528.4

Homo sapiens HGF activator (HGFAC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
HGFAC (3083)
Length:
2069
CDS:
35..2002

Additional Resources:

NCBI RefSeq record:
NM_001528.4
NBCI Gene record:
HGFAC (3083)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001528.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051007 CCCGACATACAGCTTGTCTGA pLKO.1 753 CDS 100% 2.640 3.696 N HGFAC n/a
2 TRCN0000051006 CTTCGGCATCGAGAAGTACAT pLKO.1 1462 CDS 100% 4.950 3.465 N HGFAC n/a
3 TRCN0000051003 GTGTGCCACAACTCACAACTA pLKO.1 430 CDS 100% 4.950 3.465 N HGFAC n/a
4 TRCN0000051004 TGCGGCACAGAGAAATGCTTT pLKO.1 623 CDS 100% 4.950 3.465 N HGFAC n/a
5 TRCN0000427836 ACTATCCTGGTGACCTCTGTG pLKO_005 203 CDS 100% 4.050 2.835 N HGFAC n/a
6 TRCN0000422514 TGCAACATCGAGCCTGATGAG pLKO_005 866 CDS 100% 4.050 2.835 N HGFAC n/a
7 TRCN0000051005 CGTGGCTTACCTCTACGGCAT pLKO.1 1858 CDS 100% 0.720 0.504 N HGFAC n/a
8 TRCN0000031890 GCACAAGAAGAGGACGTTCTT pLKO.1 1225 CDS 100% 0.495 0.347 N Hgfac n/a
9 TRCN0000323785 GCACAAGAAGAGGACGTTCTT pLKO_005 1225 CDS 100% 0.495 0.347 N Hgfac n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001528.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06363 pDONR223 100% 99.8% 99.8% None 618C>A;693C>G n/a
2 ccsbBroad304_06363 pLX_304 0% 99.8% 99.8% V5 618C>A;693C>G n/a
3 TRCN0000477089 TTCACGTGACACGAAACTATTGAC pLX_317 14.8% 99.8% 99.8% V5 618C>A;693C>G n/a
Download CSV