Transcript: Human NM_001549.6

Homo sapiens interferon induced protein with tetratricopeptide repeats 3 (IFIT3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
IFIT3 (3437)
Length:
2390
CDS:
78..1550

Additional Resources:

NCBI RefSeq record:
NM_001549.6
NBCI Gene record:
IFIT3 (3437)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001549.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293558 GCTATGGACTATTCGAATAAA pLKO_005 1017 CDS 100% 15.000 21.000 N IFIT3 n/a
2 TRCN0000115864 GCGATGTACCATCTGGATAAT pLKO.1 612 CDS 100% 13.200 18.480 N IFIT3 n/a
3 TRCN0000286167 GCGATGTACCATCTGGATAAT pLKO_005 612 CDS 100% 13.200 18.480 N IFIT3 n/a
4 TRCN0000115863 GCACCAAATTATTGGTATCTT pLKO.1 1317 CDS 100% 0.563 0.788 N IFIT3 n/a
5 TRCN0000293559 ATGTTGCTCTAAGGTACATTT pLKO_005 1661 3UTR 100% 13.200 9.240 N IFIT3 n/a
6 TRCN0000115865 CCTTCAGGCATAGGCAGTATT pLKO.1 1425 CDS 100% 13.200 9.240 N IFIT3 n/a
7 TRCN0000286166 CCTTCAGGCATAGGCAGTATT pLKO_005 1425 CDS 100% 13.200 9.240 N IFIT3 n/a
8 TRCN0000115866 CACTGAGTTCAAAGCTACAAT pLKO.1 215 CDS 100% 5.625 3.938 N IFIT3 n/a
9 TRCN0000298159 CACTGAGTTCAAAGCTACAAT pLKO_005 215 CDS 100% 5.625 3.938 N IFIT3 n/a
10 TRCN0000115862 CACAGTGAAATCCCGTCTCTA pLKO.1 1794 3UTR 100% 4.950 2.475 Y IFIT3 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1719 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001549.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06427 pDONR223 100% 99.8% 99.5% None 83A>T;527T>C n/a
2 ccsbBroad304_06427 pLX_304 0% 99.8% 99.5% V5 83A>T;527T>C n/a
3 TRCN0000478873 TGCACCCTTGTACCACCCCTATCG pLX_317 23.6% 99.8% 99.5% V5 83A>T;527T>C n/a
4 ccsbBroadEn_06428 pDONR223 100% 99.8% 99.5% None 7G>N;131T>C n/a
5 ccsbBroad304_06428 pLX_304 0% 99.8% 99.5% V5 7G>N;131T>C n/a
6 TRCN0000467954 TCTCAAAGGTTAATTTATAGAGGT pLX_317 27.1% 99.8% 99.5% V5 7G>N;131T>C n/a
Download CSV