Transcript: Human NM_001587.4

Homo sapiens OCRL inositol polyphosphate-5-phosphatase (OCRL), transcript variant b, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
OCRL (4952)
Length:
5149
CDS:
182..2863

Additional Resources:

NCBI RefSeq record:
NM_001587.4
NBCI Gene record:
OCRL (4952)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001587.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304002 GTGTCGATACATTCGTGATAT pLKO_005 1177 CDS 100% 13.200 18.480 N OCRL n/a
2 TRCN0000048206 CGTTACTTGATGGCATTCCTT pLKO.1 2666 CDS 100% 3.000 4.200 N OCRL n/a
3 TRCN0000304001 ACGGGCAATATGAGTTAATAA pLKO_005 288 CDS 100% 15.000 12.000 N OCRL n/a
4 TRCN0000331282 ACTCGGGAGAAGATAAGATTG pLKO_005 2121 CDS 100% 10.800 8.640 N OCRL n/a
5 TRCN0000304000 CAAGCCAAAGTTACCATATTT pLKO_005 3059 3UTR 100% 15.000 10.500 N OCRL n/a
6 TRCN0000382050 GATCTCGGGCTCCAAGTATTT pLKO_005 2899 3UTR 100% 13.200 9.240 N OCRL n/a
7 TRCN0000380748 GCATTCCAAAGCCAAGTATAA pLKO_005 1096 CDS 100% 13.200 9.240 N OCRL n/a
8 TRCN0000048204 GCTTCCGAGATGCCATAGAAA pLKO.1 2638 CDS 100% 5.625 3.938 N OCRL n/a
9 TRCN0000300487 GCTTCCGAGATGCCATAGAAA pLKO_005 2638 CDS 100% 5.625 3.938 N OCRL n/a
10 TRCN0000048207 GCGGAAGCTCTTTGTACCAAA pLKO.1 799 CDS 100% 4.950 3.465 N OCRL n/a
11 TRCN0000048205 GCTTCTTATATTTGCCAGAAA pLKO.1 1150 CDS 100% 4.950 3.465 N OCRL n/a
12 TRCN0000048203 GCCAAGTATAAGAAAGTTCAA pLKO.1 1106 CDS 100% 4.950 2.970 N OCRL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001587.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06668 pDONR223 100% 99.9% 99.8% None 1282T>G;2166A>G n/a
2 ccsbBroad304_06668 pLX_304 0% 99.9% 99.8% V5 1282T>G;2166A>G n/a
3 TRCN0000476592 TAGTGTACTGACCAGTTAATTGTC pLX_317 14.2% 99.9% 99.8% V5 1282T>G;2166A>G n/a
Download CSV