Transcript: Human NM_001683.5

Homo sapiens ATPase plasma membrane Ca2+ transporting 2 (ATP2B2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ATP2B2 (491)
Length:
8829
CDS:
442..4038

Additional Resources:

NCBI RefSeq record:
NM_001683.5
NBCI Gene record:
ATP2B2 (491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001683.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429542 ATCCTGACAGACGACAATTTC pLKO_005 2860 CDS 100% 13.200 18.480 N ATP2B2 n/a
2 TRCN0000425769 CCGTCTACGTGCAGTACTTTG pLKO_005 1607 CDS 100% 10.800 15.120 N ATP2B2 n/a
3 TRCN0000043103 CCCACTTAATAAGAGCTTATT pLKO.1 5651 3UTR 100% 1.320 1.848 N ATP2B2 n/a
4 TRCN0000043105 CCAGTGGATGTGGTGCATATT pLKO.1 3492 CDS 100% 13.200 9.240 N ATP2B2 n/a
5 TRCN0000423592 GCATGGTCACTGGCGACAATA pLKO_005 2489 CDS 100% 13.200 9.240 N ATP2B2 n/a
6 TRCN0000043107 CCAGATAGTGATCGTGCAGTT pLKO.1 3432 CDS 100% 4.050 2.835 N ATP2B2 n/a
7 TRCN0000043106 CGAGATGGTAAAGAAGGTGAT pLKO.1 2268 CDS 100% 4.050 2.835 N ATP2B2 n/a
8 TRCN0000437646 TCGCCATCAAGTGTGGCATTA pLKO_005 2528 CDS 100% 10.800 7.560 N Atp2b2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001683.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10690 pDONR223 100% 58.5% 57.2% None (many diffs) n/a
2 ccsbBroad304_10690 pLX_304 0% 58.5% 57.2% V5 (many diffs) n/a
3 TRCN0000475250 GAGGATAACAACCGCTTTCCTTCA pLX_317 9.9% 58.5% 57.2% V5 (many diffs) n/a
Download CSV