Transcript: Human NM_001737.5

Homo sapiens complement C9 (C9), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
C9 (735)
Length:
2770
CDS:
32..1711

Additional Resources:

NCBI RefSeq record:
NM_001737.5
NBCI Gene record:
C9 (735)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001737.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423405 CGTCTGTACCATGCAATTTAA pLKO_005 2094 3UTR 100% 15.000 21.000 N C9 n/a
2 TRCN0000057188 CTTCTCTCTTAGGTCTATAAT pLKO.1 1844 3UTR 100% 15.000 21.000 N C9 n/a
3 TRCN0000435205 GCGGAAAGGTGTTGAACTAAA pLKO_005 1135 CDS 100% 13.200 18.480 N C9 n/a
4 TRCN0000421633 AGATGCGACTTCGGTGTAATG pLKO_005 372 CDS 100% 10.800 15.120 N C9 n/a
5 TRCN0000057192 GCAGGCTATGGGATCAACATT pLKO.1 497 CDS 100% 5.625 4.500 N C9 n/a
6 TRCN0000057189 CCGAACATTACGAAGAACAAA pLKO.1 672 CDS 100% 5.625 3.938 N C9 n/a
7 TRCN0000057191 CCAGTTATGACCCAGAGCTAA pLKO.1 105 CDS 100% 4.950 3.465 N C9 n/a
8 TRCN0000057190 GCCTGTGAAATCAGTAAACAA pLKO.1 1643 CDS 100% 5.625 3.375 N C9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001737.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00190 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00190 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469254 TCTGCCGCAATCGCGGGCAAATGA pLX_317 25.1% 100% 100% V5 n/a
Download CSV