Transcript: Human NM_001756.4

Homo sapiens serpin family A member 6 (SERPINA6), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SERPINA6 (866)
Length:
1477
CDS:
90..1307

Additional Resources:

NCBI RefSeq record:
NM_001756.4
NBCI Gene record:
SERPINA6 (866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001756.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373494 ACTGAGCCGGGACACGATTAA pLKO_005 926 CDS 100% 13.200 18.480 N SERPINA6 n/a
2 TRCN0000003604 GTCATCAAAGGTGGTCCATAA pLKO.1 1112 CDS 100% 10.800 8.640 N SERPINA6 n/a
3 TRCN0000010804 CGTGGGCAATGGGACTGTCTT pLKO.1 860 CDS 100% 1.650 1.320 N SERPINA6 n/a
4 TRCN0000373495 CCTCGTCCTGGTCAACTATAT pLKO_005 671 CDS 100% 13.200 9.240 N SERPINA6 n/a
5 TRCN0000373433 CAGACATCAAGCACTACTATG pLKO_005 523 CDS 100% 10.800 7.560 N SERPINA6 n/a
6 TRCN0000003605 GCAGTCGAGCACCATCAGTTA pLKO.1 794 CDS 100% 4.950 3.465 N SERPINA6 n/a
7 TRCN0000003606 GTACATTCCAAAGGTCACCAT pLKO.1 986 CDS 100% 2.640 1.848 N SERPINA6 n/a
8 TRCN0000003603 CAGATGAACTACGTGGGCAAT pLKO.1 849 CDS 100% 4.050 2.430 N SERPINA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001756.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00232 pDONR223 100% 99.9% 99.7% None 736T>G n/a
2 ccsbBroad304_00232 pLX_304 0% 99.9% 99.7% V5 736T>G n/a
3 TRCN0000468101 GCCTGTCTTCGATTATGCGCAGCA pLX_317 29.3% 99.9% 99.7% V5 736T>G n/a
Download CSV