Transcript: Human NM_001759.4

Homo sapiens cyclin D2 (CCND2), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CCND2 (894)
Length:
6493
CDS:
280..1149

Additional Resources:

NCBI RefSeq record:
NM_001759.4
NBCI Gene record:
CCND2 (894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001759.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298622 AGGAACTGTGTACGCCATTTA pLKO_005 1549 3UTR 100% 13.200 18.480 N CCND2 n/a
2 TRCN0000045293 CGACTTTAAGTTTGCCATGTA pLKO.1 849 CDS 100% 4.950 6.930 N CCND2 n/a
3 TRCN0000286546 CGACTTTAAGTTTGCCATGTA pLKO_005 849 CDS 100% 4.950 6.930 N CCND2 n/a
4 TRCN0000045295 GAAGGACATCCAACCCTACAT pLKO.1 423 CDS 100% 4.950 3.465 N CCND2 n/a
5 TRCN0000286545 GAAGGACATCCAACCCTACAT pLKO_005 423 CDS 100% 4.950 3.465 N CCND2 n/a
6 TRCN0000045294 TCACCAACACAGACGTGGATT pLKO.1 983 CDS 100% 4.950 3.465 N CCND2 n/a
7 TRCN0000286478 TCACCAACACAGACGTGGATT pLKO_005 983 CDS 100% 4.950 3.465 N CCND2 n/a
8 TRCN0000045297 CGTCGATGATCGCAACTGGAA pLKO.1 875 CDS 100% 2.640 1.848 N CCND2 n/a
9 TRCN0000286477 CGTCGATGATCGCAACTGGAA pLKO_005 875 CDS 100% 2.640 1.848 N CCND2 n/a
10 TRCN0000045296 CCTTCCGCAGTGCTCCTACTT pLKO.1 390 CDS 100% 1.650 1.155 N CCND2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001759.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05948 pDONR223 100% 99.8% 100% None 570C>G n/a
2 ccsbBroad304_05948 pLX_304 0% 99.8% 100% V5 570C>G n/a
3 TRCN0000467811 CAGAGTGTGCTTTTGCATGCGCGC pLX_317 44% 99.8% 100% V5 570C>G n/a
Download CSV