Transcript: Human NM_001769.4

Homo sapiens CD9 molecule (CD9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
CD9 (928)
Length:
1225
CDS:
101..787

Additional Resources:

NCBI RefSeq record:
NM_001769.4
NBCI Gene record:
CD9 (928)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001769.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296952 CACAAGGATGAGGTGATTAAG pLKO_005 437 CDS 100% 13.200 18.480 N CD9 n/a
2 TRCN0000066393 CCTGCAATGAAAGGTACTATA pLKO.1 1061 3UTR 100% 13.200 18.480 N Cd9 n/a
3 TRCN0000296958 CCTGCAATGAAAGGTACTATA pLKO_005 1061 3UTR 100% 13.200 18.480 N CD9 n/a
4 TRCN0000334848 CCTGCAATGAAAGGTACTATA pLKO_005 1061 3UTR 100% 13.200 18.480 N Cd9 n/a
5 TRCN0000379729 TCAAAGAGGTCTTCGACAATA pLKO_005 654 CDS 100% 13.200 18.480 N CD9 n/a
6 TRCN0000380009 CAAGAAGGACGTACTCGAAAC pLKO_005 604 CDS 100% 6.000 8.400 N CD9 n/a
7 TRCN0000057472 CATGATATTTGGCATGATCTT pLKO.1 718 CDS 100% 4.950 6.930 N CD9 n/a
8 TRCN0000057470 GCTGTTCGGATTTAACTTCAT pLKO.1 139 CDS 100% 4.950 6.930 N CD9 n/a
9 TRCN0000291711 GCTGTTCGGATTTAACTTCAT pLKO_005 139 CDS 100% 4.950 6.930 N CD9 n/a
10 TRCN0000057469 CATTGGACTATGGCTCCGATT pLKO.1 190 CDS 100% 4.050 5.670 N CD9 n/a
11 TRCN0000296954 CTTCGAGCAAGAAACTAATAA pLKO_005 232 CDS 100% 15.000 12.000 N CD9 n/a
12 TRCN0000057468 CGACAATAAATTCCACATCAT pLKO.1 667 CDS 100% 4.950 3.960 N CD9 n/a
13 TRCN0000296953 TTCTACACAGGAGTCTATATT pLKO_005 266 CDS 100% 15.000 10.500 N CD9 n/a
14 TRCN0000348368 CCACAAGGATGAGGTGATTAA pLKO_005 436 CDS 100% 13.200 9.240 N Cd9 n/a
15 TRCN0000066394 CCCACAAGGATGAGGTGATTA pLKO.1 435 CDS 100% 13.200 9.240 N Cd9 n/a
16 TRCN0000057471 CGGCTTCCTCTTGGTGATATT pLKO.1 379 CDS 100% 13.200 9.240 N CD9 n/a
17 TRCN0000379855 GCATTGCCGTGGTCATGATAT pLKO_005 705 CDS 100% 13.200 9.240 N CD9 n/a
18 TRCN0000380058 TGTCCTTGCCATTGGACTATG pLKO_005 181 CDS 100% 10.800 7.560 N CD9 n/a
19 TRCN0000382123 GCCATCCACTATGCGTTGAAC pLKO_005 533 CDS 100% 4.950 3.465 N CD9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001769.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05957 pDONR223 100% 99.8% 100% None 6G>C n/a
2 ccsbBroad304_05957 pLX_304 0% 99.8% 100% V5 6G>C n/a
3 TRCN0000466115 GAACGAAATCACACAGCTCGGCAC pLX_317 62.5% 99.8% 100% V5 6G>C n/a
Download CSV