Transcript: Human NM_001785.3

Homo sapiens cytidine deaminase (CDA), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CDA (978)
Length:
809
CDS:
34..474

Additional Resources:

NCBI RefSeq record:
NM_001785.3
NBCI Gene record:
CDA (978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001785.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051291 GCCGGATGGTACGTATATTGT pLKO.1 390 CDS 100% 5.625 7.875 N CDA n/a
2 TRCN0000051289 GAGAATCTTCAAAGGGTGCAA pLKO.1 174 CDS 100% 2.640 3.696 N CDA n/a
3 TRCN0000051288 GCCAGTGACATGCAAGATGAT pLKO.1 295 CDS 100% 4.950 3.960 N CDA n/a
4 TRCN0000417394 ATGTTTCCAGATTACACTCCA pLKO_005 592 3UTR 100% 2.640 2.112 N CDA n/a
5 TRCN0000051290 CATGAGAGAGTTTGGCACCAA pLKO.1 348 CDS 100% 2.640 1.848 N CDA n/a
6 TRCN0000051292 CTGTGCTGAACGGACCGCTAT pLKO.1 225 CDS 100% 1.350 0.945 N CDA n/a
7 TRCN0000421267 GGCCAAGAAGTCAGCCTACTG pLKO_005 105 CDS 100% 1.350 0.945 N CDA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001785.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05968 pDONR223 100% 99.5% 99.3% None 79A>C;435C>T n/a
2 TRCN0000473428 CGAGTATAACTGTGCTCAGCGTCA pLX_317 34.7% 99.5% 99.3% V5 79A>C;435C>T n/a
Download CSV