Transcript: Human NM_001848.3

Homo sapiens collagen type VI alpha 1 chain (COL6A1), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
COL6A1 (1291)
Length:
4203
CDS:
82..3168

Additional Resources:

NCBI RefSeq record:
NM_001848.3
NBCI Gene record:
COL6A1 (1291)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116959 GTGGGCATCAAAGACGTGTTT pLKO.1 2341 CDS 100% 4.950 6.930 N COL6A1 n/a
2 TRCN0000300422 GTGGGCATCAAAGACGTGTTT pLKO_005 2341 CDS 100% 4.950 6.930 N COL6A1 n/a
3 TRCN0000304070 CCGTCGATGCCATGGACTTTA pLKO_005 2789 CDS 100% 13.200 10.560 N COL6A1 n/a
4 TRCN0000371016 GCCTGCAGAACTTCGAGATTG pLKO_005 1961 CDS 100% 10.800 7.560 N COL6A1 n/a
5 TRCN0000116957 GCTGTGTCTTACTAGAAACAA pLKO.1 4034 3UTR 100% 5.625 3.938 N COL6A1 n/a
6 TRCN0000300353 GCTGTGTCTTACTAGAAACAA pLKO_005 4034 3UTR 100% 5.625 3.938 N COL6A1 n/a
7 TRCN0000116958 CGGAGACGATAACAACGACAT pLKO.1 1746 CDS 100% 4.050 2.835 N COL6A1 n/a
8 TRCN0000116960 CCTTTGGACTGAAAGGAGAAA pLKO.1 1178 CDS 100% 0.495 0.347 N COL6A1 n/a
9 TRCN0000300352 CCTTTGGACTGAAAGGAGAAA pLKO_005 1178 CDS 100% 0.495 0.347 N COL6A1 n/a
10 TRCN0000116961 CAAAGTCAAGTCCTTCACCAA pLKO.1 261 CDS 100% 2.640 1.584 N COL6A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.