Transcript: Human NM_001853.4

Homo sapiens collagen type IX alpha 3 chain (COL9A3), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
COL9A3 (1299)
Length:
2497
CDS:
16..2070

Additional Resources:

NCBI RefSeq record:
NM_001853.4
NBCI Gene record:
COL9A3 (1299)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001853.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116429 TGACCTTCAGTGCCCAAGTAT pLKO.1 525 CDS 100% 5.625 4.500 N COL9A3 n/a
2 TRCN0000371821 TCAGGCTCTCGAAGCTCATAA pLKO_005 2050 CDS 100% 13.200 9.240 N COL9A3 n/a
3 TRCN0000371879 AGCACAGTGGACGGTCATGAA pLKO_005 2108 3UTR 100% 4.950 3.465 N COL9A3 n/a
4 TRCN0000116428 AGCGAACAAATTGCACAGTTA pLKO.1 1615 CDS 100% 4.950 3.465 N COL9A3 n/a
5 TRCN0000116431 CCGGGCAAGGACGGCCAGAAT pLKO.1 922 CDS 100% 0.000 0.000 N COL9A3 n/a
6 TRCN0000116430 GCCTGCCAAGGAGCCGTGTTA pLKO.1 2011 CDS 100% 0.000 0.000 N COL9A3 n/a
7 TRCN0000377761 CTAAGGGAGACCAGGGTATTG pLKO_005 1325 CDS 100% 10.800 6.480 N COL9A3 n/a
8 TRCN0000116427 CCCAGCATTTGAGAGAAGGTA pLKO.1 2287 3UTR 100% 3.000 1.800 N COL9A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001853.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14592 pDONR223 58.6% 99.6% 99.5% None (many diffs) n/a
2 ccsbBroad304_14592 pLX_304 0% 99.6% 99.5% V5 (many diffs) n/a
3 TRCN0000471031 CTCGCCGATCGATCGTCTTCTGCA pLX_317 20.2% 99.6% 99.5% V5 (many diffs) n/a
Download CSV