Transcript: Human NM_001915.4

Homo sapiens cytochrome b561 (CYB561), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
CYB561 (1534)
Length:
2929
CDS:
76..831

Additional Resources:

NCBI RefSeq record:
NM_001915.4
NBCI Gene record:
CYB561 (1534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001915.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423472 GGGCAAGTATAGCGCATTTGA pLKO_005 639 CDS 100% 5.625 7.875 N CYB561 n/a
2 TRCN0000064573 CCTGCTGGTTTACCGTGTCTT pLKO.1 279 CDS 100% 4.950 6.930 N CYB561 n/a
3 TRCN0000064575 GCACATCTTTGCGCTCGTCAT pLKO.1 345 CDS 100% 4.050 5.670 N CYB561 n/a
4 TRCN0000439880 GAGTCCCTCCAGCCTGAATAA pLKO_005 1253 3UTR 100% 13.200 9.240 N CYB561 n/a
5 TRCN0000064574 CGCCCACAGCACATCTTCTTT pLKO.1 544 CDS 100% 5.625 3.938 N CYB561 n/a
6 TRCN0000064576 GATCCTTGTCTTTGTCCTGTA pLKO.1 450 CDS 100% 4.050 2.835 N CYB561 n/a
7 TRCN0000064577 ACTGCCTTACTACGTGGCCTT pLKO.1 111 CDS 100% 2.160 1.512 N CYB561 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001915.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00402 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00402 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468004 TAGCCGCTCCCCGAGGCTAACCTG pLX_317 46.1% 100% 100% V5 n/a
4 ccsbBroadEn_06069 pDONR223 100% 99.8% 99.6% None 16G>T n/a
5 ccsbBroad304_06069 pLX_304 0% 99.8% 99.6% V5 16G>T n/a
6 TRCN0000481133 AGAACTATATCTCGGACACGCACC pLX_317 63.3% 99.8% 99.6% V5 16G>T n/a
Download CSV